EMAIL THIS PAGE TO A FRIEND

IL1B

interleukin 1, beta

111 Gene Product Result for
Synonyms: IL-1 IL1-BETA IL1F2
Gene ID:
Human(3553) Summary: The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is produced by activated macrophages as a proprotein, which is proteolytically processed to its active form by caspase 1 (CASP1/ICE). This cytokine is an important mediator of the inflammatory response, and is involved in a variety of cellular activities, including cell proliferation, differentiation, and apoptosis. The induction of cyclooxygenase-2 (PTGS2/COX2) by this cytokine in the central nervous system (CNS) is found to contribute to inflammatory pain hypersensitivity. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. [provided by RefSeq, Jul 2008]
Mouse(16176) interleukin 1 beta
Rat(24494) interleukin 1 beta
Zebrafish(557541) interleukin 1, beta
domestic cat(768274) interleukin 1, beta
cow(281251) interleukin 1, beta
Horse(100034237) interleukin 1, beta
dog(403974) interleukin 1, beta
Zebrafish(405770) interleukin 1, beta
chicken(395196) interleukin 1, beta
Goat(100860816) interleukin 1, beta
Domestic Rabbit(100008990) interleukin 1, beta
domestic guinea pig(100135556) interleukin 1 beta
naked mole-rat(101704309) interleukin 1, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
P9672 Probucol analytical standard human pricing
S8307 SB 203580 solid, ≥98% (HPLC) human pricing
S0193 SKF-86002 ≥98% (HPLC), solid human, rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
100633 1-(2-Hydroxyphenyl)-3-phenyl-2-propenone 98% human, rat pricing
136123 trans-Chalcone 97% human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008361 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008361 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008361 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000576 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000576 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000576 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023751 MISSION® esiRNA esiRNA human IL1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000576 Rosetta Predictions human pricing
NM_031512 Rosetta Predictions rat pricing
NM_008361 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028205 predicted 482
2 SASI_Hs02_00302835 predicted 726
3 SASI_Hs01_00028206 predicted 838
4 SASI_Hs01_00028208 predicted 852
5 SASI_Hs01_00028209 predicted 861
6 SASI_Hs01_00028210 predicted 580
7 SASI_Hs01_00028211 predicted 386
8 SASI_Hs01_00028212 predicted 384
9 SASI_Hs01_00028213 predicted 236
10 SASI_Hs01_00028214 predicted 761
11 SASI_Hs01_00028207 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031512 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060095 predicted 390
2 SASI_Rn01_00060096 predicted 692
3 SASI_Rn01_00060097 predicted 989
4 SASI_Rn01_00060099 predicted 399
5 SASI_Rn02_00264637 predicted 594
6 SASI_Rn01_00060100 predicted 822
7 SASI_Rn02_00264638 predicted 602
8 SASI_Rn01_00060101 predicted 519
9 SASI_Rn01_00060102 predicted 462
10 SASI_Rn01_00060103 predicted 1081
11 SASI_Rn01_00060098 predicted 971
12 SASI_Rn01_00060104 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008361 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125194 predicted 512
2 SASI_Mm01_00125196 predicted 612
3 SASI_Mm01_00125197 predicted 486
4 SASI_Mm01_00125198 predicted 598
5 SASI_Mm01_00125199 predicted 966
6 SASI_Mm01_00125200 predicted 820
7 SASI_Mm02_00313715 predicted 832
8 SASI_Mm01_00125201 predicted 528
9 SASI_Mm01_00125202 predicted 532
10 SASI_Mm02_00313716 predicted 525
11 SASI_Mm01_00125195 predicted 613
12 SASI_Mm01_00125203 predicted 959
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008361
IL1B MISSION shRNA Bacterial Glycerol Stock
interleukin 1, beta
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008361.3-1067s21c1
Sequence:CCGGGGGCAACCACTTACCTATTTACTCGAGTAAATAGGTAAGTGGTTGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008361.3-525s21c1
Sequence:CCGGATCAACCAACAAGTGATATTCCTCGAGGAATATCACTTGTTGGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008361.3-827s21c1
Sequence:CCGGCAACAGTGGTCAGGACATAATCTCGAGATTATGTCCTGACCACTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008361.2-1069s1c1
Sequence:CCGGGCAACCACTTACCTATTTATTCTCGAGAATAAATAGGTAAGTGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008361.2-602s1c1
Sequence:CCGGCCTCAAAGGAAAGAATCTATACTCGAGTATAGATTCTTTCCTTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008361.2-506s1c1
Sequence:CCGGCCACCTCAATGGACAGAATATCTCGAGATATTCTGTCCATTGAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008361.2-227s1c1
Sequence:CCGGGCAGCACATCAACAAGAGCTTCTCGAGAAGCTCTTGTTGATGTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008361.2-711s1c1
Sequence:CCGGCGGTTTGTCTTCAACAAGATACTCGAGTATCTTGTTGAAGACAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008361
IL1B MISSION shRNA shRNA Plasmid DNA
interleukin 1, beta
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008361.3-1067s21c1
Sequence:CCGGGGGCAACCACTTACCTATTTACTCGAGTAAATAGGTAAGTGGTTGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008361.3-525s21c1
Sequence:CCGGATCAACCAACAAGTGATATTCCTCGAGGAATATCACTTGTTGGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008361.3-827s21c1
Sequence:CCGGCAACAGTGGTCAGGACATAATCTCGAGATTATGTCCTGACCACTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008361.2-1069s1c1
Sequence:CCGGGCAACCACTTACCTATTTATTCTCGAGAATAAATAGGTAAGTGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008361.2-602s1c1
Sequence:CCGGCCTCAAAGGAAAGAATCTATACTCGAGTATAGATTCTTTCCTTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008361.2-506s1c1
Sequence:CCGGCCACCTCAATGGACAGAATATCTCGAGATATTCTGTCCATTGAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008361.2-227s1c1
Sequence:CCGGGCAGCACATCAACAAGAGCTTCTCGAGAAGCTCTTGTTGATGTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008361.2-711s1c1
Sequence:CCGGCGGTTTGTCTTCAACAAGATACTCGAGTATCTTGTTGAAGACAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008361
IL1B MISSION shRNA Lentiviral Transduction Particles
interleukin 1, beta
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008361.3-1067s21c1
Sequence:CCGGGGGCAACCACTTACCTATTTACTCGAGTAAATAGGTAAGTGGTTGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008361.3-525s21c1
Sequence:CCGGATCAACCAACAAGTGATATTCCTCGAGGAATATCACTTGTTGGTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008361.3-827s21c1
Sequence:CCGGCAACAGTGGTCAGGACATAATCTCGAGATTATGTCCTGACCACTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008361.2-1069s1c1
Sequence:CCGGGCAACCACTTACCTATTTATTCTCGAGAATAAATAGGTAAGTGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008361.2-602s1c1
Sequence:CCGGCCTCAAAGGAAAGAATCTATACTCGAGTATAGATTCTTTCCTTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008361.2-506s1c1
Sequence:CCGGCCACCTCAATGGACAGAATATCTCGAGATATTCTGTCCATTGAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008361.2-227s1c1
Sequence:CCGGGCAGCACATCAACAAGAGCTTCTCGAGAAGCTCTTGTTGATGTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008361.2-711s1c1
Sequence:CCGGCGGTTTGTCTTCAACAAGATACTCGAGTATCTTGTTGAAGACAAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000576
IL1B MISSION shRNA Bacterial Glycerol Stock
interleukin 1, beta
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000576.2-751s21c1
Sequence:CCGGATCAATAACAAGCTGGAATTTCTCGAGAAATTCCAGCTTGTTATTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000576.2-1134s21c1
Sequence:CCGGTCACCTCTCCTACTCACTTAACTCGAGTTAAGTGAGTAGGAGAGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000576.2-866s21c1
Sequence:CCGGCTGACTTCACCATGCAATTTGCTCGAGCAAATTGCATGGTGAAGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000576.2-1228s21c1
Sequence:CCGGAGCAACCGCTTCCCTATTTATCTCGAGATAAATAGGGAAGCGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000576.2-852s1c1
Sequence:CCGGCGGCCAGGATATAACTGACTTCTCGAGAAGTCAGTTATATCCTGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000576.2-726s1c1
Sequence:CCGGGCGATTTGTCTTCAACAAGATCTCGAGATCTTGTTGAAGACAAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000576.2-148s1c1
Sequence:CCGGGACTTGTTCTTTGAAGCTGATCTCGAGATCAGCTTCAAAGAACAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000576.2-405s1c1
Sequence:CCGGCACATGGGATAACGAGGCTTACTCGAGTAAGCCTCGTTATCCCATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000576.2-644s1c1
Sequence:CCGGCCTGCGTGTTGAAAGATGATACTCGAGTATCATCTTTCAACACGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000576
IL1B MISSION shRNA shRNA Plasmid DNA
interleukin 1, beta
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000576.2-751s21c1
Sequence:CCGGATCAATAACAAGCTGGAATTTCTCGAGAAATTCCAGCTTGTTATTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000576.2-1134s21c1
Sequence:CCGGTCACCTCTCCTACTCACTTAACTCGAGTTAAGTGAGTAGGAGAGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000576.2-866s21c1
Sequence:CCGGCTGACTTCACCATGCAATTTGCTCGAGCAAATTGCATGGTGAAGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000576.2-1228s21c1
Sequence:CCGGAGCAACCGCTTCCCTATTTATCTCGAGATAAATAGGGAAGCGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000576.2-852s1c1
Sequence:CCGGCGGCCAGGATATAACTGACTTCTCGAGAAGTCAGTTATATCCTGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000576.2-726s1c1
Sequence:CCGGGCGATTTGTCTTCAACAAGATCTCGAGATCTTGTTGAAGACAAATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000576.2-148s1c1
Sequence:CCGGGACTTGTTCTTTGAAGCTGATCTCGAGATCAGCTTCAAAGAACAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000576.2-405s1c1
Sequence:CCGGCACATGGGATAACGAGGCTTACTCGAGTAAGCCTCGTTATCCCATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000576.2-644s1c1
Sequence:CCGGCCTGCGTGTTGAAAGATGATACTCGAGTATCATCTTTCAACACGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000576
IL1B MISSION shRNA Lentiviral Transduction Particles
interleukin 1, beta
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000576.2-751s21c1
Sequence:CCGGATCAATAACAAGCTGGAATTTCTCGAGAAATTCCAGCTTGTTATTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000576.2-1134s21c1
Sequence:CCGGTCACCTCTCCTACTCACTTAACTCGAGTTAAGTGAGTAGGAGAGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000576.2-866s21c1
Sequence:CCGGCTGACTTCACCATGCAATTTGCTCGAGCAAATTGCATGGTGAAGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000576.2-1228s21c1
Sequence:CCGGAGCAACCGCTTCCCTATTTATCTCGAGATAAATAGGGAAGCGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000576.2-852s1c1
Sequence:CCGGCGGCCAGGATATAACTGACTTCTCGAGAAGTCAGTTATATCCTGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000576.2-726s1c1
Sequence:CCGGGCGATTTGTCTTCAACAAGATCTCGAGATCTTGTTGAAGACAAATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000576.2-148s1c1
Sequence:CCGGGACTTGTTCTTTGAAGCTGATCTCGAGATCAGCTTCAAAGAACAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000576.2-405s1c1
Sequence:CCGGCACATGGGATAACGAGGCTTACTCGAGTAAGCCTCGTTATCCCATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000576.2-644s1c1
Sequence:CCGGCCTGCGTGTTGAAAGATGATACTCGAGTATCATCTTTCAACACGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)