EMAIL THIS PAGE TO A FRIEND

IL1F10

interleukin 1 family, member 10 (theta)

81 Gene Product Result for
Synonyms: FIL1-theta IL-1HY2 IL-38 IL1-theta IL1HY2
UniProtKB ID: Q8WWZ1, Q53SR9, Q56AT8, Q7RTZ5, Q969H5, Q9BYX1
Gene ID:
Human(84639) Summary: The protein encoded by this gene is a member of the interleukin 1 cytokine family. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. This cytokine is thought to participate in a network of interleukin 1 family members to regulate adapted and innate immune responses. Two alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
Mouse(215274) interleukin 1 family, member 10
Rat(362077) interleukin 1 family, member 10
domestic guinea pig(100722140) interleukin 1 family, member 10 (theta)
naked mole-rat(101705995) interleukin 1 family, member 10 (theta)
sheep(101111084) interleukin 1 family, member 10 (theta)
dog(611873) interleukin 1 family, member 10 (theta)
cow(615702) interleukin 1 family, member 10 (theta)
domestic cat(101096973) interleukin 1 family, member 10 (theta)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0684 Human IL1F10 / Interleukin-1 Family Member 10 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153077 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153077 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153077 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032556 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032556 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032556 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032556 Rosetta Predictions human pricing
NM_173161 Rosetta Predictions human pricing
NM_001108571 Rosetta Predictions rat pricing
NM_153077 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032556 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020671 predicted 606
2 SASI_Hs01_00020672 predicted 656
3 SASI_Hs01_00020673 predicted 697
4 SASI_Hs01_00020675 predicted 667
5 SASI_Hs01_00020676 predicted 653
6 SASI_Hs01_00020677 predicted 609
7 SASI_Hs01_00020678 predicted 703
8 SASI_Hs01_00020679 predicted 701
9 SASI_Hs01_00020680 predicted 674
10 SASI_Hs02_00360064 predicted 667
11 SASI_Hs01_00020674 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153215 predicted 261
2 SASI_Hs01_00153216 predicted 312
3 SASI_Hs01_00153217 predicted 353
4 SASI_Hs01_00153219 predicted 325
5 SASI_Hs01_00153220 predicted 310
6 SASI_Hs01_00153221 predicted 265
7 SASI_Hs01_00153222 predicted 361
8 SASI_Hs01_00153223 predicted 364
9 SASI_Hs01_00153224 predicted 333
10 SASI_Hs02_00368130 predicted 320
11 SASI_Hs01_00153218 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108571 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239949 predicted 443
2 SASI_Rn02_00239950 predicted 438
3 SASI_Rn02_00239951 predicted 569
4 SASI_Rn02_00239952 predicted 585
5 SASI_Rn02_00239953 predicted 284
6 SASI_Rn02_00239954 predicted 593
7 SASI_Rn02_00239955 predicted 552
8 SASI_Rn02_00239956 predicted 567
9 SASI_Rn02_00239957 predicted 302
10 SASI_Rn02_00239958 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153077 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188799 predicted 224
2 SASI_Mm01_00188800 predicted 286
3 SASI_Mm02_00342905 predicted 222
4 SASI_Mm01_00188802 predicted 214
5 SASI_Mm01_00188803 predicted 301
6 SASI_Mm01_00188804 predicted 277
7 SASI_Mm01_00188805 predicted 310
8 SASI_Mm01_00188806 predicted 222
9 SASI_Mm01_00188807 predicted 208
10 SASI_Mm01_00188808 predicted 283
11 SASI_Mm01_00188801 predicted 253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153077
IL1F10 MISSION shRNA Bacterial Glycerol Stock
interleukin 1 family, member 10 (theta)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153077.1-143s1c1
Sequence:CCGGCCAGAGAAGGTCTGTATCCTTCTCGAGAAGGATACAGACCTTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153077.1-117s1c1
Sequence:CCGGGAGACCCTGATTCAGACAATTCTCGAGAATTGTCTGAATCAGGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153077.1-130s1c1
Sequence:CCGGAGACAATTATAGTCCAGAGAACTCGAGTTCTCTGGACTATAATTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153077.1-290s1c1
Sequence:CCGGGACCTATACAAGGGAGGTGAACTCGAGTTCACCTCCCTTGTATAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153077.1-304s1c1
Sequence:CCGGAGGTGAACAAACCACCCGTTTCTCGAGAAACGGGTGGTTTGTTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153077
IL1F10 MISSION shRNA shRNA Plasmid DNA
interleukin 1 family, member 10 (theta)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153077.1-143s1c1
Sequence:CCGGCCAGAGAAGGTCTGTATCCTTCTCGAGAAGGATACAGACCTTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153077.1-117s1c1
Sequence:CCGGGAGACCCTGATTCAGACAATTCTCGAGAATTGTCTGAATCAGGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153077.1-130s1c1
Sequence:CCGGAGACAATTATAGTCCAGAGAACTCGAGTTCTCTGGACTATAATTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153077.1-290s1c1
Sequence:CCGGGACCTATACAAGGGAGGTGAACTCGAGTTCACCTCCCTTGTATAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153077.1-304s1c1
Sequence:CCGGAGGTGAACAAACCACCCGTTTCTCGAGAAACGGGTGGTTTGTTCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153077
IL1F10 MISSION shRNA Lentiviral Transduction Particles
interleukin 1 family, member 10 (theta)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153077.1-143s1c1
Sequence:CCGGCCAGAGAAGGTCTGTATCCTTCTCGAGAAGGATACAGACCTTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153077.1-117s1c1
Sequence:CCGGGAGACCCTGATTCAGACAATTCTCGAGAATTGTCTGAATCAGGGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153077.1-130s1c1
Sequence:CCGGAGACAATTATAGTCCAGAGAACTCGAGTTCTCTGGACTATAATTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153077.1-290s1c1
Sequence:CCGGGACCTATACAAGGGAGGTGAACTCGAGTTCACCTCCCTTGTATAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153077.1-304s1c1
Sequence:CCGGAGGTGAACAAACCACCCGTTTCTCGAGAAACGGGTGGTTTGTTCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032556
IL1F10 MISSION shRNA Bacterial Glycerol Stock
interleukin 1 family, member 10 (theta)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032556.4-536s1c1
Sequence:CCGGGCAGAGAAGATCTGCATACTTCTCGAGAAGTATGCAGATCTTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032556.4-549s1c1
Sequence:CCGGGCATACTTCCTAACAGAGGCTCTCGAGAGCCTCTGTTAGGAAGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032556.4-665s1c1
Sequence:CCGGGAGGATGTGAACATTGAGGAACTCGAGTTCCTCAATGTTCACATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032556.4-808s1c1
Sequence:CCGGGCAGCCAGTACAGCTCACCAACTCGAGTTGGTGAGCTGTACTGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032556.4-683s1c1
Sequence:CCGGGAACTGTACAAAGGTGGTGAACTCGAGTTCACCACCTTTGTACAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032556.4-463s21c1
Sequence:CCGGTGCAGACCAGAAGGCTCTATACTCGAGTATAGAGCCTTCTGGTCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032556.4-938s21c1
Sequence:CCGGGGTCTATGGTAGGCAGAATAACTCGAGTTATTCTGCCTACCATAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032556.4-1084s21c1
Sequence:CCGGTCCTTGTGGGCTCAGTTTAATCTCGAGATTAAACTGAGCCCACAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032556
IL1F10 MISSION shRNA shRNA Plasmid DNA
interleukin 1 family, member 10 (theta)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032556.4-536s1c1
Sequence:CCGGGCAGAGAAGATCTGCATACTTCTCGAGAAGTATGCAGATCTTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032556.4-549s1c1
Sequence:CCGGGCATACTTCCTAACAGAGGCTCTCGAGAGCCTCTGTTAGGAAGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032556.4-665s1c1
Sequence:CCGGGAGGATGTGAACATTGAGGAACTCGAGTTCCTCAATGTTCACATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032556.4-808s1c1
Sequence:CCGGGCAGCCAGTACAGCTCACCAACTCGAGTTGGTGAGCTGTACTGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032556.4-683s1c1
Sequence:CCGGGAACTGTACAAAGGTGGTGAACTCGAGTTCACCACCTTTGTACAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032556.4-463s21c1
Sequence:CCGGTGCAGACCAGAAGGCTCTATACTCGAGTATAGAGCCTTCTGGTCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032556.4-938s21c1
Sequence:CCGGGGTCTATGGTAGGCAGAATAACTCGAGTTATTCTGCCTACCATAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032556.4-1084s21c1
Sequence:CCGGTCCTTGTGGGCTCAGTTTAATCTCGAGATTAAACTGAGCCCACAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032556
IL1F10 MISSION shRNA Lentiviral Transduction Particles
interleukin 1 family, member 10 (theta)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032556.4-536s1c1
Sequence:CCGGGCAGAGAAGATCTGCATACTTCTCGAGAAGTATGCAGATCTTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032556.4-549s1c1
Sequence:CCGGGCATACTTCCTAACAGAGGCTCTCGAGAGCCTCTGTTAGGAAGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032556.4-665s1c1
Sequence:CCGGGAGGATGTGAACATTGAGGAACTCGAGTTCCTCAATGTTCACATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032556.4-808s1c1
Sequence:CCGGGCAGCCAGTACAGCTCACCAACTCGAGTTGGTGAGCTGTACTGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032556.4-683s1c1
Sequence:CCGGGAACTGTACAAAGGTGGTGAACTCGAGTTCACCACCTTTGTACAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032556.4-463s21c1
Sequence:CCGGTGCAGACCAGAAGGCTCTATACTCGAGTATAGAGCCTTCTGGTCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032556.4-938s21c1
Sequence:CCGGGGTCTATGGTAGGCAGAATAACTCGAGTTATTCTGCCTACCATAGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032556.4-1084s21c1
Sequence:CCGGTCCTTGTGGGCTCAGTTTAATCTCGAGATTAAACTGAGCCCACAAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)