EMAIL THIS PAGE TO A FRIEND

Il1f5

11 Gene Product Result for
Species: Mouse Il1f5(54450)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019451 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019451 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019451 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019451 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019451 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055163 predicted 763
2 SASI_Mm01_00055164 predicted 776
3 SASI_Mm01_00055165 predicted 845
4 SASI_Mm01_00055166 predicted 272
5 SASI_Mm01_00055167 predicted 545
6 SASI_Mm01_00055168 predicted 426
7 SASI_Mm01_00055169 predicted 629
8 SASI_Mm01_00055170 predicted 232
9 SASI_Mm01_00055171 predicted 399
10 SASI_Mm02_00324439 predicted 750
11 SASI_Mm01_00055162 predicted 792
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019451
Il1f5 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019451.1-205s1c1
Sequence:CCGGGCACGCAGAGAAGGTCATTAACTCGAGTTAATGACCTTCTCTGCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019451.1-152s1c1
Sequence:CCGGTCAGCCTTGAAGGTACTGTATCTCGAGATACAGTACCTTCAAGGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019451.1-313s1c1
Sequence:CCGGCCTATCTTGTGGGACAGAGAACTCGAGTTCTCTGTCCCACAAGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019451.1-545s1c1
Sequence:CCGGCCCATCACAGACTTCTACTTTCTCGAGAAAGTAGAAGTCTGTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019451.1-278s1c1
Sequence:CCGGCCTGTCATCCTGGGCGTTCAACTCGAGTTGAACGCCCAGGATGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019451
Il1f5 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019451.1-205s1c1
Sequence:CCGGGCACGCAGAGAAGGTCATTAACTCGAGTTAATGACCTTCTCTGCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019451.1-152s1c1
Sequence:CCGGTCAGCCTTGAAGGTACTGTATCTCGAGATACAGTACCTTCAAGGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019451.1-313s1c1
Sequence:CCGGCCTATCTTGTGGGACAGAGAACTCGAGTTCTCTGTCCCACAAGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019451.1-545s1c1
Sequence:CCGGCCCATCACAGACTTCTACTTTCTCGAGAAAGTAGAAGTCTGTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019451.1-278s1c1
Sequence:CCGGCCTGTCATCCTGGGCGTTCAACTCGAGTTGAACGCCCAGGATGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019451
Il1f5 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019451.1-205s1c1
Sequence:CCGGGCACGCAGAGAAGGTCATTAACTCGAGTTAATGACCTTCTCTGCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019451.1-152s1c1
Sequence:CCGGTCAGCCTTGAAGGTACTGTATCTCGAGATACAGTACCTTCAAGGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019451.1-313s1c1
Sequence:CCGGCCTATCTTGTGGGACAGAGAACTCGAGTTCTCTGTCCCACAAGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019451.1-545s1c1
Sequence:CCGGCCCATCACAGACTTCTACTTTCTCGAGAAAGTAGAAGTCTGTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019451.1-278s1c1
Sequence:CCGGCCTGTCATCCTGGGCGTTCAACTCGAGTTGAACGCCCAGGATGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)