EMAIL THIS PAGE TO A FRIEND

Il1f8

21 Gene Product Result for
Gene ID:
dog(483068) interleukin 1 family, member 8 (eta)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_130058 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_130058 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_130058 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_027163 Rosetta Predictions mouse pricing
XM_130058 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027163 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331673 predicted 228
2 SASI_Mm02_00331674 predicted 465
3 SASI_Mm02_00331675 predicted 251
4 SASI_Mm02_00331676 predicted 400
5 SASI_Mm02_00331677 predicted 402
6 SASI_Mm02_00331678 predicted 398
7 SASI_Mm02_00331679 predicted 404
8 SASI_Mm02_00331680 predicted 289
9 SASI_Mm02_00331681 predicted 231
10 SASI_Mm02_00331682 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130058 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243002 predicted 407
2 SASI_Mm01_00243003 predicted 404
3 SASI_Mm01_00243004 predicted 298
4 SASI_Mm01_00243005 predicted 404
5 SASI_Mm01_00243006 predicted 235
6 SASI_Mm01_00243007 predicted 261
7 SASI_Mm01_00243008 predicted 415
8 SASI_Mm01_00243009 predicted 421
9 SASI_Mm01_00243010 predicted 237
10 SASI_Mm01_00243011 predicted 389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_130058
Il1f8 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130058.1-525s1c1
Sequence:CCGGGCTGGTTTATAGCCACCTCTTCTCGAGAAGAGGTGGCTATAAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130058.1-272s1c1
Sequence:CCGGCCTGTCATTCTTAGCTTGATACTCGAGTATCAAGCTAAGAATGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130058.1-143s1c1
Sequence:CCGGCCGAATCATAACACTATGCATCTCGAGATGCATAGTGTTATGATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130058.1-343s1c1
Sequence:CCGGCCTGGGAATCAAGAACAGAAACTCGAGTTTCTGTTCTTGATTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130058.1-393s1c1
Sequence:CCGGGCAAACCAACTTTGCAGCTTACTCGAGTAAGCTGCAAAGTTGGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_130058
Il1f8 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130058.1-525s1c1
Sequence:CCGGGCTGGTTTATAGCCACCTCTTCTCGAGAAGAGGTGGCTATAAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130058.1-272s1c1
Sequence:CCGGCCTGTCATTCTTAGCTTGATACTCGAGTATCAAGCTAAGAATGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130058.1-143s1c1
Sequence:CCGGCCGAATCATAACACTATGCATCTCGAGATGCATAGTGTTATGATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130058.1-343s1c1
Sequence:CCGGCCTGGGAATCAAGAACAGAAACTCGAGTTTCTGTTCTTGATTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130058.1-393s1c1
Sequence:CCGGGCAAACCAACTTTGCAGCTTACTCGAGTAAGCTGCAAAGTTGGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_130058
Il1f8 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130058.1-525s1c1
Sequence:CCGGGCTGGTTTATAGCCACCTCTTCTCGAGAAGAGGTGGCTATAAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130058.1-272s1c1
Sequence:CCGGCCTGTCATTCTTAGCTTGATACTCGAGTATCAAGCTAAGAATGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130058.1-143s1c1
Sequence:CCGGCCGAATCATAACACTATGCATCTCGAGATGCATAGTGTTATGATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130058.1-343s1c1
Sequence:CCGGCCTGGGAATCAAGAACAGAAACTCGAGTTTCTGTTCTTGATTCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130058.1-393s1c1
Sequence:CCGGGCAAACCAACTTTGCAGCTTACTCGAGTAAGCTGCAAAGTTGGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)