EMAIL THIS PAGE TO A FRIEND

IL1R2

interleukin 1 receptor, type II

69 Gene Product Result for
Synonyms: CD121b CDw121b IL-1R-2 IL-1RT-2 IL-1RT2 IL1R2c IL1RB
UniProtKB ID: P27930, D3DVJ5, Q6LCE6, Q9UE68
Gene ID:
Human(7850) Summary: The protein encoded by this gene is a cytokine receptor that belongs to the interleukin 1 receptor family. This protein binds interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I(IL1R1/IL1RA), and acts as a decoy receptor that inhibits the activity of its ligands. Interleukin 4 (IL4) is reported to antagonize the activity of interleukin 1 by inducing the expression and release of this cytokine. This gene and three other genes form a cytokine receptor gene cluster on chromosome 2q12. Alternative splicing results in multiple transcript variants and protein isoforms. Alternative splicing produces both membrane-bound and soluble proteins. A soluble protein is also produced by proteolytic cleavage. [provided by RefSeq, May 2012]
Mouse(16178) interleukin 1 receptor, type II
Rat(117022) interleukin 1 receptor, type II
chicken(418715) interleukin 1 receptor, type II
dog(481330) interleukin 1 receptor, type II
cow(515700) interleukin 1 receptor, type II
domestic cat(101080961) interleukin 1 receptor, type II
domestic guinea pig(100723930) interleukin 1 receptor, type II
naked mole-rat(101710536) interleukin 1 receptor, type II
sheep(101103308) interleukin 1 receptor, type II
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004633 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004633 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004633 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010555 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010555 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010555 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004633 Rosetta Predictions human pricing
NM_173343 Rosetta Predictions human pricing
NM_053953 Rosetta Predictions rat pricing
NM_010555 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232167 predicted 612
2 SASI_Hs01_00232168 predicted 614
3 SASI_Hs01_00232169 predicted 540
4 SASI_Hs01_00232171 predicted 1142
5 SASI_Hs01_00232172 predicted 417
6 SASI_Hs01_00232173 predicted 1129
7 SASI_Hs01_00232174 predicted 1231
8 SASI_Hs01_00232175 predicted 414
9 SASI_Hs01_00232176 predicted 533
10 SASI_Hs02_00338035 predicted 417
11 SASI_Hs01_00232170 predicted 1178
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054075 predicted 557
2 SASI_Hs01_00054076 predicted 561
3 SASI_Hs01_00054077 predicted 492
4 SASI_Hs01_00054079 predicted 1089
5 SASI_Hs01_00054080 predicted 362
6 SASI_Hs01_00054081 predicted 1088
7 SASI_Hs01_00054082 predicted 1178
8 SASI_Hs01_00054083 predicted 364
9 SASI_Hs01_00054084 predicted 487
10 SASI_Hs02_00368178 predicted 375
11 SASI_Hs01_00054078 predicted 1128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053953 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044007 predicted 759
2 SASI_Rn01_00044008 predicted 514
3 SASI_Rn01_00044009 predicted 803
4 SASI_Rn01_00044010 predicted 460
5 SASI_Rn01_00044011 predicted 1101
6 SASI_Rn01_00044012 predicted 727
7 SASI_Rn01_00044013 predicted 910
8 SASI_Rn01_00044015 predicted 692
9 SASI_Rn01_00044016 predicted 843
10 SASI_Rn02_00266916 predicted 651
11 SASI_Rn01_00044014 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010555 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185008 predicted 628
2 SASI_Mm01_00185009 predicted 746
3 SASI_Mm01_00185010 predicted 880
4 SASI_Mm01_00185011 predicted 769
5 SASI_Mm01_00185012 predicted 524
6 SASI_Mm01_00185013 predicted 658
7 SASI_Mm01_00185014 predicted 894
8 SASI_Mm01_00185015 predicted 726
9 SASI_Mm02_00318819 predicted 613
10 SASI_Mm02_00318820 predicted 436
11 SASI_Mm01_00185006 predicted 230
12 SASI_Mm01_00185007 predicted 661
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004633
IL1R2 MISSION shRNA Bacterial Glycerol Stock
interleukin 1 receptor, type II
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004633.3-993s21c1
Sequence:CCGGCAATCCCGTGTAAGGTGTTTCCTCGAGGAAACACCTTACACGGGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004633.3-931s21c1
Sequence:CCGGGACCATTCCTGTGATCATTTCCTCGAGGAAATGATCACAGGAATGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004633.3-630s1c1
Sequence:CCGGCGTTCATCTCATACCCGCAAACTCGAGTTTGCGGGTATGAGATGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004633.3-1210s1c1
Sequence:CCGGTGTCCATAATACCCTGAGTTTCTCGAGAAACTCAGGGTATTATGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004633.3-1138s1c1
Sequence:CCGGGAACTACATTGAAGTGCCATTCTCGAGAATGGCACTTCAATGTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004633.3-552s1c1
Sequence:CCGGGCACTACTAGAAATGCTTCTTCTCGAGAAGAAGCATTTCTAGTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004633.3-721s1c1
Sequence:CCGGCGTGAAGATTCAATGGTACAACTCGAGTTGTACCATTGAATCTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004633
IL1R2 MISSION shRNA shRNA Plasmid DNA
interleukin 1 receptor, type II
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004633.3-993s21c1
Sequence:CCGGCAATCCCGTGTAAGGTGTTTCCTCGAGGAAACACCTTACACGGGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004633.3-931s21c1
Sequence:CCGGGACCATTCCTGTGATCATTTCCTCGAGGAAATGATCACAGGAATGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004633.3-630s1c1
Sequence:CCGGCGTTCATCTCATACCCGCAAACTCGAGTTTGCGGGTATGAGATGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004633.3-1210s1c1
Sequence:CCGGTGTCCATAATACCCTGAGTTTCTCGAGAAACTCAGGGTATTATGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004633.3-1138s1c1
Sequence:CCGGGAACTACATTGAAGTGCCATTCTCGAGAATGGCACTTCAATGTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004633.3-552s1c1
Sequence:CCGGGCACTACTAGAAATGCTTCTTCTCGAGAAGAAGCATTTCTAGTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004633.3-721s1c1
Sequence:CCGGCGTGAAGATTCAATGGTACAACTCGAGTTGTACCATTGAATCTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004633
IL1R2 MISSION shRNA Lentiviral Transduction Particles
interleukin 1 receptor, type II
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004633.3-993s21c1
Sequence:CCGGCAATCCCGTGTAAGGTGTTTCCTCGAGGAAACACCTTACACGGGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004633.3-931s21c1
Sequence:CCGGGACCATTCCTGTGATCATTTCCTCGAGGAAATGATCACAGGAATGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004633.3-630s1c1
Sequence:CCGGCGTTCATCTCATACCCGCAAACTCGAGTTTGCGGGTATGAGATGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004633.3-1210s1c1
Sequence:CCGGTGTCCATAATACCCTGAGTTTCTCGAGAAACTCAGGGTATTATGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004633.3-1138s1c1
Sequence:CCGGGAACTACATTGAAGTGCCATTCTCGAGAATGGCACTTCAATGTAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004633.3-552s1c1
Sequence:CCGGGCACTACTAGAAATGCTTCTTCTCGAGAAGAAGCATTTCTAGTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004633.3-721s1c1
Sequence:CCGGCGTGAAGATTCAATGGTACAACTCGAGTTGTACCATTGAATCTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010555
IL1R2 MISSION shRNA Bacterial Glycerol Stock
interleukin 1 receptor, type II
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010555.2-732s1c1
Sequence:CCGGGCAGGCTATTACAGATGTGTTCTCGAGAACACATCTGTAATAGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010555.2-1144s1c1
Sequence:CCGGCCACAGTCAAAGAAGTCTCTTCTCGAGAAGAGACTTCTTTGACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010555.2-618s1c1
Sequence:CCGGGATGGAAAGATACAGTGGTATCTCGAGATACCACTGTATCTTTCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010555.2-962s1c1
Sequence:CCGGCACGTTTATCTCGGCTGCTTACTCGAGTAAGCAGCCGAGATAAACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010555.2-334s1c1
Sequence:CCGGCCTGGAGTAAATTGGACTCTTCTCGAGAAGAGTCCAATTTACTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010555
IL1R2 MISSION shRNA shRNA Plasmid DNA
interleukin 1 receptor, type II
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010555.2-732s1c1
Sequence:CCGGGCAGGCTATTACAGATGTGTTCTCGAGAACACATCTGTAATAGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010555.2-1144s1c1
Sequence:CCGGCCACAGTCAAAGAAGTCTCTTCTCGAGAAGAGACTTCTTTGACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010555.2-618s1c1
Sequence:CCGGGATGGAAAGATACAGTGGTATCTCGAGATACCACTGTATCTTTCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010555.2-962s1c1
Sequence:CCGGCACGTTTATCTCGGCTGCTTACTCGAGTAAGCAGCCGAGATAAACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010555.2-334s1c1
Sequence:CCGGCCTGGAGTAAATTGGACTCTTCTCGAGAAGAGTCCAATTTACTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010555
IL1R2 MISSION shRNA Lentiviral Transduction Particles
interleukin 1 receptor, type II
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010555.2-732s1c1
Sequence:CCGGGCAGGCTATTACAGATGTGTTCTCGAGAACACATCTGTAATAGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010555.2-1144s1c1
Sequence:CCGGCCACAGTCAAAGAAGTCTCTTCTCGAGAAGAGACTTCTTTGACTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010555.2-618s1c1
Sequence:CCGGGATGGAAAGATACAGTGGTATCTCGAGATACCACTGTATCTTTCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010555.2-962s1c1
Sequence:CCGGCACGTTTATCTCGGCTGCTTACTCGAGTAAGCAGCCGAGATAAACGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010555.2-334s1c1
Sequence:CCGGCCTGGAGTAAATTGGACTCTTCTCGAGAAGAGTCCAATTTACTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)