EMAIL THIS PAGE TO A FRIEND

IL1RAP

interleukin 1 receptor accessory protein

348 Gene Product Result for
Synonyms: C3orf13 IL-1RAcP IL1R3
UniProtKB ID: Q9NPH3, B1NLD0, D3DNW0, O14915, Q86WJ7
Gene ID:
Human(3556) Summary: Interleukin 1 induces synthesis of acute phase and proinflammatory proteins during infection, tissue damage, or stress, by forming a complex at the cell membrane with an interleukin 1 receptor and an accessory protein. This gene encodes the interleukin 1 receptor accessory protein. The protein is a necessary part of the interleukin 1 receptor complex which initiates signalling events that result in the activation of interleukin 1-responsive genes. Alternative splicing of this gene results in two transcript variants encoding two different isoforms, one membrane-bound and one soluble. The ratio of soluble to membrane-bound forms increases during acute-phase induction or stress. [provided by RefSeq, Nov 2009]
Mouse(16180) interleukin 1 receptor accessory protein
Rat(25466) interleukin 1 receptor accessory protein
sheep(101108354) interleukin 1 receptor accessory protein
Domestic Rabbit(100341281) interleukin 1 receptor accessory protein
domestic guinea pig(100714704) interleukin 1 receptor accessory protein
naked mole-rat(101707386) interleukin 1 receptor accessory protein
chicken(424908) interleukin 1 receptor accessory protein
cow(539334) interleukin 1 receptor accessory protein
Horse(100068726) interleukin 1 receptor accessory protein
domestic cat(101094125) interleukin 1 receptor accessory protein
dog(488126) interleukin 1 receptor accessory protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0690 Human IL1RAP / Interleukin-1 Receptor Accessory Protein ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134103 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134103 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134103 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002182 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002182 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002182 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002182 Rosetta Predictions human pricing
NM_134470 Rosetta Predictions human pricing
NM_012968 Rosetta Predictions rat pricing
NM_008364 Rosetta Predictions mouse pricing
NM_134103 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219886 predicted 526
2 SASI_Hs01_00219888 predicted 286
3 SASI_Hs01_00219889 predicted 554
4 SASI_Hs01_00219890 predicted 925
5 SASI_Hs01_00219891 predicted 734
6 SASI_Hs02_00333397 predicted 932
7 SASI_Hs01_00219893 predicted 683
8 SASI_Hs01_00219894 predicted 643
9 SASI_Hs01_00219895 predicted 335
10 SASI_Hs02_00333398 predicted 945
11 SASI_Hs01_00219887 predicted 816
12 SASI_Hs01_00219892 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163644 predicted 527
2 SASI_Hs01_00163646 predicted 287
3 SASI_Hs01_00163647 predicted 550
4 SASI_Hs01_00163648 predicted 927
5 SASI_Hs01_00163649 predicted 734
6 SASI_Hs02_00363335 predicted 936
7 SASI_Hs01_00163651 predicted 682
8 SASI_Hs01_00163652 predicted 641
9 SASI_Hs01_00163653 predicted 333
10 SASI_Hs02_00363336 predicted 943
11 SASI_Hs01_00163645 predicted 813
12 SASI_Hs01_00163650 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012968 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058168 predicted 458
2 SASI_Rn01_00058169 predicted 634
3 SASI_Rn01_00058170 predicted 576
4 SASI_Rn01_00058171 predicted 823
5 SASI_Rn01_00058172 predicted 541
6 SASI_Rn01_00058173 predicted 985
7 SASI_Rn01_00058174 predicted 422
8 SASI_Rn01_00058175 predicted 844
9 SASI_Rn02_00260569 predicted 242
10 SASI_Rn01_00058176 predicted 903
11 SASI_Rn01_00058177 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008364 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053002 predicted 598
2 SASI_Mm01_00053003 predicted 732
3 SASI_Mm01_00053004 predicted 612
4 SASI_Mm01_00053005 predicted 453
5 SASI_Mm01_00053006 predicted 754
6 SASI_Mm01_00053007 predicted 911
7 SASI_Mm01_00053008 predicted 665
8 SASI_Mm01_00053009 predicted 660
9 SASI_Mm01_00053010 predicted 655
10 SASI_Mm01_00053011 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134103 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120130 predicted 596
2 SASI_Mm01_00120131 predicted 733
3 SASI_Mm01_00120132 predicted 601
4 SASI_Mm01_00120133 predicted 453
5 SASI_Mm01_00120134 predicted 761
6 SASI_Mm01_00120135 predicted 917
7 SASI_Mm01_00120136 predicted 667
8 SASI_Mm01_00120137 predicted 657
9 SASI_Mm01_00120138 predicted 652
10 SASI_Mm01_00120139 predicted 871
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134103
VALIDATED
IL1RAP MISSION shRNA Bacterial Glycerol Stock
interleukin 1 receptor accessory protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134103.1-737s1c1
Sequence:CCGGCCTTGGTTTCAAATAACGGAACTCGAGTTCCGTTATTTGAAACCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134103.1-926s1c1
Sequence:CCGGCCTGCAAAGTCTATTTCAGTTCTCGAGAACTGAAATAGACTTTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134103.1-613s1c1
Sequence:CCGGCCAAATGTAGACGGATACTTTCTCGAGAAAGTATCCGTCTACATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134103.1-447s1c1
Sequence:CCGGCCTCAATGACACGGGCAATTACTCGAGTAATTGCCCGTGTCATTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134103.1-1162s1c1
Sequence:CCGGGCTGCCAAGGTGAAACAGAAACTCGAGTTTCTGTTTCACCTTGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134103
VALIDATED
IL1RAP MISSION shRNA shRNA Plasmid DNA
interleukin 1 receptor accessory protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134103.1-737s1c1
Sequence:CCGGCCTTGGTTTCAAATAACGGAACTCGAGTTCCGTTATTTGAAACCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134103.1-926s1c1
Sequence:CCGGCCTGCAAAGTCTATTTCAGTTCTCGAGAACTGAAATAGACTTTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134103.1-613s1c1
Sequence:CCGGCCAAATGTAGACGGATACTTTCTCGAGAAAGTATCCGTCTACATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134103.1-447s1c1
Sequence:CCGGCCTCAATGACACGGGCAATTACTCGAGTAATTGCCCGTGTCATTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134103.1-1162s1c1
Sequence:CCGGGCTGCCAAGGTGAAACAGAAACTCGAGTTTCTGTTTCACCTTGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134103
VALIDATED
IL1RAP MISSION shRNA Lentiviral Transduction Particles
interleukin 1 receptor accessory protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134103.1-737s1c1
Sequence:CCGGCCTTGGTTTCAAATAACGGAACTCGAGTTCCGTTATTTGAAACCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134103.1-926s1c1
Sequence:CCGGCCTGCAAAGTCTATTTCAGTTCTCGAGAACTGAAATAGACTTTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134103.1-613s1c1
Sequence:CCGGCCAAATGTAGACGGATACTTTCTCGAGAAAGTATCCGTCTACATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134103.1-447s1c1
Sequence:CCGGCCTCAATGACACGGGCAATTACTCGAGTAATTGCCCGTGTCATTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134103.1-1162s1c1
Sequence:CCGGGCTGCCAAGGTGAAACAGAAACTCGAGTTTCTGTTTCACCTTGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002182
IL1RAP MISSION shRNA Bacterial Glycerol Stock
interleukin 1 receptor accessory protein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002182.2-477s1c1
Sequence:CCGGCGCATTAGTAAGGAGAAAGATCTCGAGATCTTTCTCCTTACTAATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002182.2-1889s1c1
Sequence:CCGGCCTCTCGTATTCATCTTTGAACTCGAGTTCAAAGATGAATACGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002182.2-638s1c1
Sequence:CCGGCCCAGTGCATAAACTGTATATCTCGAGATATACAGTTTATGCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002182.2-1340s1c1
Sequence:CCGGCCATGTTTACTGGCTAGAGATCTCGAGATCTCTAGCCAGTAAACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002182.2-2301s21c1
Sequence:CCGGGGTCATGAGTTTCCGAGTATACTCGAGTATACTCGGAAACTCATGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002182.2-994s21c1
Sequence:CCGGTCATTCCCTGTACGGTCTATTCTCGAGAATAGACCGTACAGGGAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002182.2-1760s21c1
Sequence:CCGGGACGGTGCTCACGGTCATTAACTCGAGTTAATGACCGTGAGCACCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002182
IL1RAP MISSION shRNA shRNA Plasmid DNA
interleukin 1 receptor accessory protein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002182.2-477s1c1
Sequence:CCGGCGCATTAGTAAGGAGAAAGATCTCGAGATCTTTCTCCTTACTAATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002182.2-1889s1c1
Sequence:CCGGCCTCTCGTATTCATCTTTGAACTCGAGTTCAAAGATGAATACGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002182.2-638s1c1
Sequence:CCGGCCCAGTGCATAAACTGTATATCTCGAGATATACAGTTTATGCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002182.2-1340s1c1
Sequence:CCGGCCATGTTTACTGGCTAGAGATCTCGAGATCTCTAGCCAGTAAACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002182.2-2301s21c1
Sequence:CCGGGGTCATGAGTTTCCGAGTATACTCGAGTATACTCGGAAACTCATGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002182.2-994s21c1
Sequence:CCGGTCATTCCCTGTACGGTCTATTCTCGAGAATAGACCGTACAGGGAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002182.2-1760s21c1
Sequence:CCGGGACGGTGCTCACGGTCATTAACTCGAGTTAATGACCGTGAGCACCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002182
IL1RAP MISSION shRNA Lentiviral Transduction Particles
interleukin 1 receptor accessory protein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002182.2-477s1c1
Sequence:CCGGCGCATTAGTAAGGAGAAAGATCTCGAGATCTTTCTCCTTACTAATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002182.2-1889s1c1
Sequence:CCGGCCTCTCGTATTCATCTTTGAACTCGAGTTCAAAGATGAATACGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002182.2-638s1c1
Sequence:CCGGCCCAGTGCATAAACTGTATATCTCGAGATATACAGTTTATGCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002182.2-1340s1c1
Sequence:CCGGCCATGTTTACTGGCTAGAGATCTCGAGATCTCTAGCCAGTAAACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002182.2-2301s21c1
Sequence:CCGGGGTCATGAGTTTCCGAGTATACTCGAGTATACTCGGAAACTCATGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002182.2-994s21c1
Sequence:CCGGTCATTCCCTGTACGGTCTATTCTCGAGAATAGACCGTACAGGGAATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002182.2-1760s21c1
Sequence:CCGGGACGGTGCTCACGGTCATTAACTCGAGTTAATGACCGTGAGCACCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)