EMAIL THIS PAGE TO A FRIEND

IL1RAPL1

interleukin 1 receptor accessory protein-like 1

141 Gene Product Result for
Synonyms: IL1R8 IL1RAPL MRX10 MRX21 MRX34 OPHN4 TIGIRR-2
UniProtKB ID: Q9NZN1, A0AVG4, Q9UJ53
Gene ID:
Human(11141) Summary: The protein encoded by this gene is a member of the interleukin 1 receptor family and is similar to the interleukin 1 accessory proteins. It is most closely related to interleukin 1 receptor accessory protein-like 2 (IL1RAPL2). This gene and IL1RAPL2 are located at a region on chromosome X that is associated with X-linked non-syndromic mental retardation. Deletions and mutations in this gene were found in patients with mental retardation. This gene is expressed at a high level in post-natal brain structures involved in the hippocampal memory system, which suggests a specialized role in the physiological processes underlying memory and learning abilities. [provided by RefSeq, Jul 2008]
Mouse(331461) interleukin 1 receptor accessory protein-like 1
Rat(317553) interleukin 1 receptor accessory protein-like 1
chicken(427993) interleukin 1 receptor accessory protein-like 1
domestic cat(101082883) interleukin 1 receptor accessory protein-like 1
cow(541298) interleukin 1 receptor accessory protein-like 1
dog(491800) interleukin 1 receptor accessory protein-like 1
naked mole-rat(101706420) interleukin 1 receptor accessory protein-like 1
sheep(101117137) interleukin 1 receptor accessory protein-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014271 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014271 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014271 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_486726 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_486726 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_486726 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014271 Rosetta Predictions human pricing
NM_177935 Rosetta Predictions rat pricing
XM_486726 Rosetta Predictions mouse pricing
XM_982589 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345340 predicted 1981
2 SASI_Hs01_00012411 predicted 796
3 SASI_Hs02_00345341 predicted 2113
4 SASI_Hs01_00012413 predicted 1334
5 SASI_Hs01_00012414 predicted 1720
6 SASI_Hs01_00012415 predicted 722
7 SASI_Hs01_00012416 predicted 978
8 SASI_Hs01_00012417 predicted 1993
9 SASI_Hs01_00012418 predicted 2195
10 SASI_Hs02_00345342 predicted 1910
11 SASI_Hs01_00012412 predicted 2700
12 SASI_Hs01_00012419 predicted 1360
13 SASI_Hs01_00012420 predicted 2449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177935 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047370 predicted 1588
2 SASI_Rn01_00047371 predicted 762
3 SASI_Rn01_00047372 predicted 1156
4 SASI_Rn01_00047373 predicted 271
5 SASI_Rn02_00269600 predicted 712
6 SASI_Rn01_00047375 predicted 698
7 SASI_Rn01_00047376 predicted 1483
8 SASI_Rn01_00047377 predicted 1039
9 SASI_Rn01_00047378 predicted 1517
10 SASI_Rn02_00269601 predicted 1819
11 SASI_Rn01_00047374 predicted 1416
12 SASI_Rn01_00047379 predicted 1479
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486726 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426900 predicted 277
2 SASI_Mm02_00426901 predicted 763
3 SASI_Mm02_00426902 predicted 224
4 SASI_Mm02_00426903 predicted 761
5 SASI_Mm02_00426904 predicted 235
6 SASI_Mm02_00426905 predicted 758
7 SASI_Mm02_00426906 predicted 232
8 SASI_Mm02_00426907 predicted 759
9 SASI_Mm02_00426908 predicted 312
10 SASI_Mm02_00426909 predicted 758
11 SASI_Mm01_00259408 predicted 1090
12 SASI_Mm01_00259409 predicted 1529
13 SASI_Mm01_00259410 predicted 416
14 SASI_Mm01_00259411 predicted 1100
15 SASI_Mm01_00259412 predicted 932
16 SASI_Mm01_00259413 predicted 1346
17 SASI_Mm01_00259414 predicted 209
18 SASI_Mm01_00259415 predicted 1427
19 SASI_Mm01_00259416 predicted 836
20 SASI_Mm01_00259417 predicted 1761
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_982589 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00447891 predicted 1085
2 SASI_Mm02_00447892 predicted 1526
3 SASI_Mm02_00447893 predicted 412
4 SASI_Mm02_00447894 predicted 1094
5 SASI_Mm02_00447895 predicted 917
6 SASI_Mm02_00447896 predicted 1341
7 SASI_Mm02_00447897 predicted 203
8 SASI_Mm02_00447898 predicted 1414
9 SASI_Mm02_00447899 predicted 831
10 SASI_Mm02_00447900 predicted 1757
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014271
IL1RAPL1 MISSION shRNA Bacterial Glycerol Stock
interleukin 1 receptor accessory protein-like 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014271.3-1913s21c1
Sequence:CCGGCAAAGCAAGCGGCTGATTATTCTCGAGAATAATCAGCCGCTTGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014271.3-2100s21c1
Sequence:CCGGTCAAGCTCCTGACGGTCATTACTCGAGTAATGACCGTCAGGAGCTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014271.2-1663s1c1
Sequence:CCGGGCCAGCGTTCTCCTTCATAAACTCGAGTTTATGAAGGAGAACGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014271.2-998s1c1
Sequence:CCGGCCACTTACTGTATGAAAGTATCTCGAGATACTTTCATACAGTAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014271.2-920s1c1
Sequence:CCGGGCAAAGAAGAAGACTCCATTTCTCGAGAAATGGAGTCTTCTTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014271.2-2103s1c1
Sequence:CCGGGCTGGAAACCAGACTTCGAAACTCGAGTTTCGAAGTCTGGTTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014271.2-2506s1c1
Sequence:CCGGCGAAGCTATGAGTACGACGTACTCGAGTACGTCGTACTCATAGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014271
IL1RAPL1 MISSION shRNA shRNA Plasmid DNA
interleukin 1 receptor accessory protein-like 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014271.3-1913s21c1
Sequence:CCGGCAAAGCAAGCGGCTGATTATTCTCGAGAATAATCAGCCGCTTGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014271.3-2100s21c1
Sequence:CCGGTCAAGCTCCTGACGGTCATTACTCGAGTAATGACCGTCAGGAGCTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014271.2-1663s1c1
Sequence:CCGGGCCAGCGTTCTCCTTCATAAACTCGAGTTTATGAAGGAGAACGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014271.2-998s1c1
Sequence:CCGGCCACTTACTGTATGAAAGTATCTCGAGATACTTTCATACAGTAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014271.2-920s1c1
Sequence:CCGGGCAAAGAAGAAGACTCCATTTCTCGAGAAATGGAGTCTTCTTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014271.2-2103s1c1
Sequence:CCGGGCTGGAAACCAGACTTCGAAACTCGAGTTTCGAAGTCTGGTTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014271.2-2506s1c1
Sequence:CCGGCGAAGCTATGAGTACGACGTACTCGAGTACGTCGTACTCATAGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014271
IL1RAPL1 MISSION shRNA Lentiviral Transduction Particles
interleukin 1 receptor accessory protein-like 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014271.3-1913s21c1
Sequence:CCGGCAAAGCAAGCGGCTGATTATTCTCGAGAATAATCAGCCGCTTGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014271.3-2100s21c1
Sequence:CCGGTCAAGCTCCTGACGGTCATTACTCGAGTAATGACCGTCAGGAGCTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014271.2-1663s1c1
Sequence:CCGGGCCAGCGTTCTCCTTCATAAACTCGAGTTTATGAAGGAGAACGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014271.2-998s1c1
Sequence:CCGGCCACTTACTGTATGAAAGTATCTCGAGATACTTTCATACAGTAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014271.2-920s1c1
Sequence:CCGGGCAAAGAAGAAGACTCCATTTCTCGAGAAATGGAGTCTTCTTCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014271.2-2103s1c1
Sequence:CCGGGCTGGAAACCAGACTTCGAAACTCGAGTTTCGAAGTCTGGTTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014271.2-2506s1c1
Sequence:CCGGCGAAGCTATGAGTACGACGTACTCGAGTACGTCGTACTCATAGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_486726
IL1RAPL1 MISSION shRNA Bacterial Glycerol Stock
interleukin 1 receptor accessory protein-like 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000242215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486726.4-1529s21c1
Sequence:CCGGTCAAGCTTCTGACGGTTATTACTCGAGTAATAACCGTCAGAAGCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486726.4-1342s21c1
Sequence:CCGGCAAAGTAAGCGGCTGATTATTCTCGAGAATAATCAGCCGCTTACTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486726.4-1472s21c1
Sequence:CCGGGCAGCGAACTCCGAGGAATTACTCGAGTAATTCCTCGGAGTTCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486726.4-1051s21c1
Sequence:CCGGATCTGTTCGGTGACCATATATCTCGAGATATATGGTCACCGAACAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_486726
IL1RAPL1 MISSION shRNA shRNA Plasmid DNA
interleukin 1 receptor accessory protein-like 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000242215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486726.4-1529s21c1
Sequence:CCGGTCAAGCTTCTGACGGTTATTACTCGAGTAATAACCGTCAGAAGCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486726.4-1342s21c1
Sequence:CCGGCAAAGTAAGCGGCTGATTATTCTCGAGAATAATCAGCCGCTTACTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486726.4-1472s21c1
Sequence:CCGGGCAGCGAACTCCGAGGAATTACTCGAGTAATTCCTCGGAGTTCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486726.4-1051s21c1
Sequence:CCGGATCTGTTCGGTGACCATATATCTCGAGATATATGGTCACCGAACAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_486726
IL1RAPL1 MISSION shRNA Lentiviral Transduction Particles
interleukin 1 receptor accessory protein-like 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000242215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486726.4-1529s21c1
Sequence:CCGGTCAAGCTTCTGACGGTTATTACTCGAGTAATAACCGTCAGAAGCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486726.4-1342s21c1
Sequence:CCGGCAAAGTAAGCGGCTGATTATTCTCGAGAATAATCAGCCGCTTACTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486726.4-1472s21c1
Sequence:CCGGGCAGCGAACTCCGAGGAATTACTCGAGTAATTCCTCGGAGTTCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486726.4-1051s21c1
Sequence:CCGGATCTGTTCGGTGACCATATATCTCGAGATATATGGTCACCGAACAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)