EMAIL THIS PAGE TO A FRIEND

IL1RAPL2

interleukin 1 receptor accessory protein-like 2

82 Gene Product Result for
Synonyms: IL-1R9 IL1R9 IL1RAPL-2 TIGIRR-1
UniProtKB ID: Q9NP60, Q2M3U3, Q9NZN0
Gene ID:
Human(26280) Summary: The protein encoded by this gene is a member of the interleukin 1 receptor family. This protein is similar to the interleukin 1 accessory proteins, and is most closely related to interleukin 1 receptor accessory protein-like 1 (IL1RAPL1). This gene and IL1RAPL1 are located at a region on chromosome X that is associated with X-linked non-syndromic mental retardation. [provided by RefSeq, Jul 2008]
Mouse(60367) interleukin 1 receptor accessory protein-like 2
Rat(300913) interleukin 1 receptor accessory protein-like 2
Zebrafish(100149452) interleukin 1 receptor accessory protein-like 2
chicken(422379) interleukin 1 receptor accessory protein-like 2
dog(492045) interleukin 1 receptor accessory protein-like 2
domestic cat(101100037) interleukin 1 receptor accessory protein-like 2
Horse(100055002) interleukin 1 receptor accessory protein-like 2
cow(523444) interleukin 1 receptor accessory protein-like 2
sheep(101101957) interleukin 1 receptor accessory protein-like 2
domestic guinea pig(100726188) interleukin 1 receptor accessory protein-like 2
naked mole-rat(101700854) interleukin 1 receptor accessory protein-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030688 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030688 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030688 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017416 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017416 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017416 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045311 MISSION® esiRNA esiRNA human IL1RAPL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017416 Rosetta Predictions human pricing
XM_001054740 Rosetta Predictions rat pricing
XM_236512 Rosetta Predictions rat pricing
NM_030688 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235306 predicted 2496
2 SASI_Hs01_00235307 predicted 2142
3 SASI_Hs01_00235308 predicted 1340
4 SASI_Hs01_00235309 predicted 1069
5 SASI_Hs01_00235310 predicted 1991
6 SASI_Hs01_00235311 predicted 2230
7 SASI_Hs01_00235312 predicted 2309
8 SASI_Hs01_00235313 predicted 1680
9 SASI_Hs02_00349981 predicted 1039
10 SASI_Hs01_00235314 predicted 1490
11 SASI_Hs01_00235315 predicted 2163
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054740 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276999 predicted 2299
2 SASI_Rn02_00277000 predicted 1695
3 SASI_Rn02_00277001 predicted 1255
4 SASI_Rn02_00277002 predicted 1324
5 SASI_Rn02_00277003 predicted 1864
6 SASI_Rn02_00277004 predicted 1244
7 SASI_Rn02_00277005 predicted 2335
8 SASI_Rn02_00277006 predicted 1785
9 SASI_Rn02_00277007 predicted 1207
10 SASI_Rn02_00277008 predicted 2123
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236512 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390109 predicted 2299
2 SASI_Rn02_00390110 predicted 1702
3 SASI_Rn02_00390111 predicted 1259
4 SASI_Rn02_00390112 predicted 1327
5 SASI_Rn02_00390113 predicted 1864
6 SASI_Rn02_00390114 predicted 1244
7 SASI_Rn02_00390115 predicted 2337
8 SASI_Rn02_00390116 predicted 1787
9 SASI_Rn02_00390117 predicted 1206
10 SASI_Rn02_00390118 predicted 2115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080695 predicted 1859
2 SASI_Mm01_00080696 predicted 1521
3 SASI_Mm02_00336846 predicted 526
4 SASI_Mm01_00080697 predicted 1503
5 SASI_Mm01_00080698 predicted 1491
6 SASI_Mm02_00336847 predicted 678
7 SASI_Mm01_00080699 predicted 1595
8 SASI_Mm01_00080700 predicted 978
9 SASI_Mm01_00080701 predicted 1128
10 SASI_Mm01_00080702 predicted 2032
11 SASI_Mm01_00080703 predicted 1217
12 SASI_Mm01_00080704 predicted 1535
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030688
IL1RAPL2 MISSION shRNA Bacterial Glycerol Stock
interleukin 1 receptor accessory protein-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030688.1-2236s1c1
Sequence:CCGGCGGCTACAGTGAGAATAAATTCTCGAGAATTTATTCTCACTGTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030688.1-2154s1c1
Sequence:CCGGGCTTAGCTTCACCAGTGATATCTCGAGATATCACTGGTGAAGCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030688.1-1523s1c1
Sequence:CCGGGACGACTTATTATCGTGCTAACTCGAGTTAGCACGATAATAAGTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030688.1-537s1c1
Sequence:CCGGCCTGTGCTACAATAGCAGGATCTCGAGATCCTGCTATTGTAGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030688.1-949s1c1
Sequence:CCGGCCAATGATCTACTGGATGAAACTCGAGTTTCATCCAGTAGATCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030688
IL1RAPL2 MISSION shRNA shRNA Plasmid DNA
interleukin 1 receptor accessory protein-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030688.1-2236s1c1
Sequence:CCGGCGGCTACAGTGAGAATAAATTCTCGAGAATTTATTCTCACTGTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030688.1-2154s1c1
Sequence:CCGGGCTTAGCTTCACCAGTGATATCTCGAGATATCACTGGTGAAGCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030688.1-1523s1c1
Sequence:CCGGGACGACTTATTATCGTGCTAACTCGAGTTAGCACGATAATAAGTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030688.1-537s1c1
Sequence:CCGGCCTGTGCTACAATAGCAGGATCTCGAGATCCTGCTATTGTAGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030688.1-949s1c1
Sequence:CCGGCCAATGATCTACTGGATGAAACTCGAGTTTCATCCAGTAGATCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030688
IL1RAPL2 MISSION shRNA Lentiviral Transduction Particles
interleukin 1 receptor accessory protein-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030688.1-2236s1c1
Sequence:CCGGCGGCTACAGTGAGAATAAATTCTCGAGAATTTATTCTCACTGTAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030688.1-2154s1c1
Sequence:CCGGGCTTAGCTTCACCAGTGATATCTCGAGATATCACTGGTGAAGCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030688.1-1523s1c1
Sequence:CCGGGACGACTTATTATCGTGCTAACTCGAGTTAGCACGATAATAAGTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030688.1-537s1c1
Sequence:CCGGCCTGTGCTACAATAGCAGGATCTCGAGATCCTGCTATTGTAGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030688.1-949s1c1
Sequence:CCGGCCAATGATCTACTGGATGAAACTCGAGTTTCATCCAGTAGATCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017416
IL1RAPL2 MISSION shRNA Bacterial Glycerol Stock
interleukin 1 receptor accessory protein-like 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017416.1-2780s1c1
Sequence:CCGGCCTCCAAAGAGCTTAGCTTTACTCGAGTAAAGCTAAGCTCTTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017416.1-1735s1c1
Sequence:CCGGGCGAATTATACCTGCCATGTTCTCGAGAACATGGCAGGTATAATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017416.1-1278s1c1
Sequence:CCGGGCCTGATGTTGTGTGGTATAACTCGAGTTATACCACACAACATCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017416.1-1699s1c1
Sequence:CCGGGCACTCATCTTTGACTCAGTTCTCGAGAACTGAGTCAAAGATGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017416.1-2729s1c1
Sequence:CCGGCCCTGAAAGATACCCAGGAATCTCGAGATTCCTGGGTATCTTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017416.1-1182s21c1
Sequence:CCGGCAACAGCAGGATCCGCTATTTCTCGAGAAATAGCGGATCCTGCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017416.1-2324s21c1
Sequence:CCGGCACTAAAGCGTAGCATCAAACCTCGAGGTTTGATGCTACGCTTTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017416.1-2601s21c1
Sequence:CCGGGCACTGTTGCAGAGGTTATAACTCGAGTTATAACCTCTGCAACAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017416.1-2173s21c1
Sequence:CCGGGTGCTAACTCCAGACTATATTCTCGAGAATATAGTCTGGAGTTAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017416
IL1RAPL2 MISSION shRNA shRNA Plasmid DNA
interleukin 1 receptor accessory protein-like 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017416.1-2780s1c1
Sequence:CCGGCCTCCAAAGAGCTTAGCTTTACTCGAGTAAAGCTAAGCTCTTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017416.1-1735s1c1
Sequence:CCGGGCGAATTATACCTGCCATGTTCTCGAGAACATGGCAGGTATAATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017416.1-1278s1c1
Sequence:CCGGGCCTGATGTTGTGTGGTATAACTCGAGTTATACCACACAACATCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017416.1-1699s1c1
Sequence:CCGGGCACTCATCTTTGACTCAGTTCTCGAGAACTGAGTCAAAGATGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017416.1-2729s1c1
Sequence:CCGGCCCTGAAAGATACCCAGGAATCTCGAGATTCCTGGGTATCTTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017416.1-1182s21c1
Sequence:CCGGCAACAGCAGGATCCGCTATTTCTCGAGAAATAGCGGATCCTGCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017416.1-2324s21c1
Sequence:CCGGCACTAAAGCGTAGCATCAAACCTCGAGGTTTGATGCTACGCTTTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017416.1-2601s21c1
Sequence:CCGGGCACTGTTGCAGAGGTTATAACTCGAGTTATAACCTCTGCAACAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017416.1-2173s21c1
Sequence:CCGGGTGCTAACTCCAGACTATATTCTCGAGAATATAGTCTGGAGTTAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017416
IL1RAPL2 MISSION shRNA Lentiviral Transduction Particles
interleukin 1 receptor accessory protein-like 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017416.1-2780s1c1
Sequence:CCGGCCTCCAAAGAGCTTAGCTTTACTCGAGTAAAGCTAAGCTCTTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017416.1-1735s1c1
Sequence:CCGGGCGAATTATACCTGCCATGTTCTCGAGAACATGGCAGGTATAATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017416.1-1278s1c1
Sequence:CCGGGCCTGATGTTGTGTGGTATAACTCGAGTTATACCACACAACATCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017416.1-1699s1c1
Sequence:CCGGGCACTCATCTTTGACTCAGTTCTCGAGAACTGAGTCAAAGATGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017416.1-2729s1c1
Sequence:CCGGCCCTGAAAGATACCCAGGAATCTCGAGATTCCTGGGTATCTTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017416.1-1182s21c1
Sequence:CCGGCAACAGCAGGATCCGCTATTTCTCGAGAAATAGCGGATCCTGCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017416.1-2324s21c1
Sequence:CCGGCACTAAAGCGTAGCATCAAACCTCGAGGTTTGATGCTACGCTTTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017416.1-2601s21c1
Sequence:CCGGGCACTGTTGCAGAGGTTATAACTCGAGTTATAACCTCTGCAACAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017416.1-2173s21c1
Sequence:CCGGGTGCTAACTCCAGACTATATTCTCGAGAATATAGTCTGGAGTTAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)