EMAIL THIS PAGE TO A FRIEND

IL1RL1

interleukin 1 receptor-like 1

94 Gene Product Result for
Synonyms: DER4 FIT-1 IL33R ST2 ST2L ST2V T1
UniProtKB ID: Q01638, A8K6B3, Q53TU7, Q8NEJ3, Q9ULV7, Q9UQ44
Gene ID:
Human(9173) Summary: The protein encoded by this gene is a member of the interleukin 1 receptor family. Studies of the similar gene in mouse suggested that this receptor can be induced by proinflammatory stimuli, and may be involved in the function of helper T cells. This gene, interleukin 1 receptor, type I (IL1R1), interleukin 1 receptor, type II (IL1R2) and interleukin 1 receptor-like 2 (IL1RL2) form a cytokine receptor gene cluster in a region mapped to chromosome 2q12. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Mouse(17082) interleukin 1 receptor-like 1
Rat(25556) interleukin 1 receptor-like 1
domestic guinea pig(100725851) interleukin 1 receptor-like 1
naked mole-rat(101711878) interleukin 1 receptor-like 1
sheep(101109529) interleukin 1 receptor-like 1
Domestic Rabbit(100350150) interleukin 1 receptor-like 1
Zebrafish(407649) interleukin 1 receptor-like 1
domestic cat(101080448) interleukin 1 receptor-like 1
cow(520709) interleukin 1 receptor-like 1
Horse(100058357) interleukin 1 receptor-like 1
dog(611442) interleukin 1 receptor-like 1
chicken(374136) interleukin 1 receptor-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003856 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003856 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003856 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010743 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010743 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010743 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003856 Rosetta Predictions human pricing
NM_016232 Rosetta Predictions human pricing
NM_001127689 Rosetta Predictions rat pricing
NM_013037 Rosetta Predictions rat pricing
NM_001025602 Rosetta Predictions mouse pricing
NM_010743 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065160 predicted 521
2 SASI_Hs01_00065161 predicted 751
3 SASI_Hs01_00065162 predicted 319
4 SASI_Hs01_00065163 predicted 493
5 SASI_Hs01_00065165 predicted 918
6 SASI_Hs01_00065166 predicted 272
7 SASI_Hs02_00336436 predicted 365
8 SASI_Hs01_00065167 predicted 272
9 SASI_Hs01_00065168 predicted 675
10 SASI_Hs01_00065169 predicted 548
11 SASI_Hs01_00065164 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147142 predicted 566
2 SASI_Hs01_00147143 predicted 792
3 SASI_Hs01_00147144 predicted 351
4 SASI_Hs01_00147145 predicted 531
5 SASI_Hs01_00147147 predicted 964
6 SASI_Hs01_00147148 predicted 319
7 SASI_Hs02_00349100 predicted 409
8 SASI_Hs01_00147149 predicted 318
9 SASI_Hs01_00147150 predicted 711
10 SASI_Hs01_00147151 predicted 589
11 SASI_Hs01_00147146 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254880 predicted 563
2 SASI_Rn02_00254881 predicted 903
3 SASI_Rn02_00254882 predicted 781
4 SASI_Rn02_00254883 predicted 867
5 SASI_Rn02_00254884 predicted 873
6 SASI_Rn02_00254885 predicted 774
7 SASI_Rn02_00254886 predicted 679
8 SASI_Rn02_00254887 predicted 812
9 SASI_Rn02_00254888 predicted 686
10 SASI_Rn02_00254889 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013037 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260743 predicted 498
2 SASI_Rn02_00260744 predicted 831
3 SASI_Rn01_00069878 predicted 708
4 SASI_Rn02_00260745 predicted 793
5 SASI_Rn02_00260746 predicted 808
6 SASI_Rn02_00260747 predicted 695
7 SASI_Rn01_00069880 predicted 607
8 SASI_Rn02_00260748 predicted 742
9 SASI_Rn02_00260749 predicted 613
10 SASI_Rn02_00260750 predicted 559
11 SASI_Rn01_00069873 predicted 583
12 SASI_Rn01_00069874 predicted 727
13 SASI_Rn01_00069875 predicted 1219
14 SASI_Rn01_00069876 predicted 1228
15 SASI_Rn01_00069877 predicted 843
16 SASI_Rn01_00069879 predicted 1188
17 SASI_Rn01_00069881 predicted 1018
18 SASI_Rn01_00069882 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025602 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073606 predicted 283
2 SASI_Mm02_00287966 predicted 533
3 SASI_Mm01_00073607 predicted 464
4 SASI_Mm02_00287967 predicted 526
5 SASI_Mm02_00287968 predicted 411
6 SASI_Mm02_00287969 predicted 624
7 SASI_Mm02_00287970 predicted 661
8 SASI_Mm02_00287971 predicted 494
9 SASI_Mm02_00287972 predicted 723
10 SASI_Mm01_00073613 predicted 385
11 SASI_Mm01_00073608 predicted 388
12 SASI_Mm01_00073609 predicted 387
13 SASI_Mm01_00073610 predicted 248
14 SASI_Mm01_00073611 predicted 268
15 SASI_Mm01_00073612 predicted 258
16 SASI_Mm01_00073614 predicted 198
17 SASI_Mm01_00073615 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010743 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319243 predicted 486
2 SASI_Mm02_00319244 predicted 742
3 SASI_Mm02_00319245 predicted 669
4 SASI_Mm02_00319246 predicted 737
5 SASI_Mm02_00319247 predicted 622
6 SASI_Mm02_00319248 predicted 838
7 SASI_Mm02_00319249 predicted 877
8 SASI_Mm02_00319250 predicted 706
9 SASI_Mm02_00319251 predicted 937
10 SASI_Mm02_00319252 predicted 592
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003856
IL1RL1 MISSION shRNA Bacterial Glycerol Stock
interleukin 1 receptor-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003856.2-464s21c1
Sequence:CCGGAGTTGCTGATTCTGGTATTTACTCGAGTAAATACCAGAATCAGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003856.2-1585s21c1
Sequence:CCGGTAAGCATGGTCCGTTCTATACCTCGAGGTATAGAACGGACCATGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003856.2-525s21c1
Sequence:CCGGTATGCGAATGTCACCATATATCTCGAGATATATGGTGACATTCGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003856.2-359s21c1
Sequence:CCGGTTACACCGTGGATTGGTATTACTCGAGTAATACCAATCCACGGTGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003856.2-755s1c1
Sequence:CCGGCGCAGGTGATTACACCTGTAACTCGAGTTACAGGTGTAATCACCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003856.2-279s1c1
Sequence:CCGGGCAGCAAAGTTTAGTAAACAACTCGAGTTGTTTACTAAACTTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003856.2-1103s1c1
Sequence:CCGGCGTGAAGGAAGAGGATTTATTCTCGAGAATAAATCCTCTTCCTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003856.2-926s1c1
Sequence:CCGGCCTAACTTGCTCTGCTTGTTTCTCGAGAAACAAGCAGAGCAAGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003856.2-505s1c1
Sequence:CCGGCCACATTCAATAGGACTGGATCTCGAGATCCAGTCCTATTGAATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003856
IL1RL1 MISSION shRNA shRNA Plasmid DNA
interleukin 1 receptor-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003856.2-464s21c1
Sequence:CCGGAGTTGCTGATTCTGGTATTTACTCGAGTAAATACCAGAATCAGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003856.2-1585s21c1
Sequence:CCGGTAAGCATGGTCCGTTCTATACCTCGAGGTATAGAACGGACCATGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003856.2-525s21c1
Sequence:CCGGTATGCGAATGTCACCATATATCTCGAGATATATGGTGACATTCGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003856.2-359s21c1
Sequence:CCGGTTACACCGTGGATTGGTATTACTCGAGTAATACCAATCCACGGTGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003856.2-755s1c1
Sequence:CCGGCGCAGGTGATTACACCTGTAACTCGAGTTACAGGTGTAATCACCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003856.2-279s1c1
Sequence:CCGGGCAGCAAAGTTTAGTAAACAACTCGAGTTGTTTACTAAACTTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003856.2-1103s1c1
Sequence:CCGGCGTGAAGGAAGAGGATTTATTCTCGAGAATAAATCCTCTTCCTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003856.2-926s1c1
Sequence:CCGGCCTAACTTGCTCTGCTTGTTTCTCGAGAAACAAGCAGAGCAAGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003856.2-505s1c1
Sequence:CCGGCCACATTCAATAGGACTGGATCTCGAGATCCAGTCCTATTGAATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003856
IL1RL1 MISSION shRNA Lentiviral Transduction Particles
interleukin 1 receptor-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003856.2-464s21c1
Sequence:CCGGAGTTGCTGATTCTGGTATTTACTCGAGTAAATACCAGAATCAGCAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003856.2-1585s21c1
Sequence:CCGGTAAGCATGGTCCGTTCTATACCTCGAGGTATAGAACGGACCATGCTTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003856.2-525s21c1
Sequence:CCGGTATGCGAATGTCACCATATATCTCGAGATATATGGTGACATTCGCATATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003856.2-359s21c1
Sequence:CCGGTTACACCGTGGATTGGTATTACTCGAGTAATACCAATCCACGGTGTAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003856.2-755s1c1
Sequence:CCGGCGCAGGTGATTACACCTGTAACTCGAGTTACAGGTGTAATCACCTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003856.2-279s1c1
Sequence:CCGGGCAGCAAAGTTTAGTAAACAACTCGAGTTGTTTACTAAACTTTGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003856.2-1103s1c1
Sequence:CCGGCGTGAAGGAAGAGGATTTATTCTCGAGAATAAATCCTCTTCCTTCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003856.2-926s1c1
Sequence:CCGGCCTAACTTGCTCTGCTTGTTTCTCGAGAAACAAGCAGAGCAAGTTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003856.2-505s1c1
Sequence:CCGGCCACATTCAATAGGACTGGATCTCGAGATCCAGTCCTATTGAATGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010743
VALIDATED
IL1RL1 MISSION shRNA Bacterial Glycerol Stock
interleukin 1 receptor-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010743.2-1519s21c1
Sequence:CCGGCCAACAGGAATCTCTGTCATTCTCGAGAATGACAGAGATTCCTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010743.2-748s21c1
Sequence:CCGGCCAACAATTGACCTGTATAATCTCGAGATTATACAGGTCAATTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010743.2-1263s21c1
Sequence:CCGGGAACCTTCATGGCATGATAAGCTCGAGCTTATCATGCCATGAAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010743.2-677s21c1
Sequence:CCGGGCTGCAATATCCCTGATTATTCTCGAGAATAATCAGGGATATTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010743.1-564s1c1
Sequence:CCGGGCTGCAATATCCCTGATTATTCTCGAGAATAATCAGGGATATTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010743.2-460s21c1
Sequence:CCGGCAAAGAGGACGCTCGACTTATCTCGAGATAAGTCGAGCGTCCTCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010743.1-1046s1c1
Sequence:CCGGCGAAATGAAAGTTCCAGCAATCTCGAGATTGCTGGAACTTTCATTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010743.1-357s1c1
Sequence:CCGGGCTCGACTTATCCTGTGGAATCTCGAGATTCCACAGGATAAGTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010743.1-1403s1c1
Sequence:CCGGCCAACAGGAATCTCTGTCATTCTCGAGAATGACAGAGATTCCTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010743.1-425s1c1
Sequence:CCGGCGGATCTTTGTCTCAAGAGATCTCGAGATCTCTTGAGACAAAGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010743
VALIDATED
IL1RL1 MISSION shRNA shRNA Plasmid DNA
interleukin 1 receptor-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010743.2-1519s21c1
Sequence:CCGGCCAACAGGAATCTCTGTCATTCTCGAGAATGACAGAGATTCCTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010743.2-748s21c1
Sequence:CCGGCCAACAATTGACCTGTATAATCTCGAGATTATACAGGTCAATTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010743.2-1263s21c1
Sequence:CCGGGAACCTTCATGGCATGATAAGCTCGAGCTTATCATGCCATGAAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010743.2-677s21c1
Sequence:CCGGGCTGCAATATCCCTGATTATTCTCGAGAATAATCAGGGATATTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010743.1-564s1c1
Sequence:CCGGGCTGCAATATCCCTGATTATTCTCGAGAATAATCAGGGATATTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010743.2-460s21c1
Sequence:CCGGCAAAGAGGACGCTCGACTTATCTCGAGATAAGTCGAGCGTCCTCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010743.1-1046s1c1
Sequence:CCGGCGAAATGAAAGTTCCAGCAATCTCGAGATTGCTGGAACTTTCATTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010743.1-357s1c1
Sequence:CCGGGCTCGACTTATCCTGTGGAATCTCGAGATTCCACAGGATAAGTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010743.1-1403s1c1
Sequence:CCGGCCAACAGGAATCTCTGTCATTCTCGAGAATGACAGAGATTCCTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010743.1-425s1c1
Sequence:CCGGCGGATCTTTGTCTCAAGAGATCTCGAGATCTCTTGAGACAAAGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010743
VALIDATED
IL1RL1 MISSION shRNA Lentiviral Transduction Particles
interleukin 1 receptor-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010743.2-1519s21c1
Sequence:CCGGCCAACAGGAATCTCTGTCATTCTCGAGAATGACAGAGATTCCTGTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010743.2-748s21c1
Sequence:CCGGCCAACAATTGACCTGTATAATCTCGAGATTATACAGGTCAATTGTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010743.2-1263s21c1
Sequence:CCGGGAACCTTCATGGCATGATAAGCTCGAGCTTATCATGCCATGAAGGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010743.2-677s21c1
Sequence:CCGGGCTGCAATATCCCTGATTATTCTCGAGAATAATCAGGGATATTGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010743.1-564s1c1
Sequence:CCGGGCTGCAATATCCCTGATTATTCTCGAGAATAATCAGGGATATTGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010743.2-460s21c1
Sequence:CCGGCAAAGAGGACGCTCGACTTATCTCGAGATAAGTCGAGCGTCCTCTTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010743.1-1046s1c1
Sequence:CCGGCGAAATGAAAGTTCCAGCAATCTCGAGATTGCTGGAACTTTCATTTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010743.1-357s1c1
Sequence:CCGGGCTCGACTTATCCTGTGGAATCTCGAGATTCCACAGGATAAGTCGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010743.1-1403s1c1
Sequence:CCGGCCAACAGGAATCTCTGTCATTCTCGAGAATGACAGAGATTCCTGTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010743.1-425s1c1
Sequence:CCGGCGGATCTTTGTCTCAAGAGATCTCGAGATCTCTTGAGACAAAGATCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)