EMAIL THIS PAGE TO A FRIEND

IL1RL2

interleukin 1 receptor-like 2

59 Gene Product Result for
Synonyms: IL-1Rrp2 IL-36R IL1R-rp2 IL1RRP2
UniProtKB ID: Q9HB29, Q13525, Q45H74, Q53TU8, Q587I8
Gene ID:
Human(8808) Summary: The protein encoded by this gene is a member of the interleukin 1 receptor family. An experiment with transient gene expression demonstrated that this receptor was incapable of binding to interleukin 1 alpha and interleukin 1 beta with high affinity. This gene and four other interleukin 1 receptor family genes, including interleukin 1 receptor, type I (IL1R1), interleukin 1 receptor, type II (IL1R2), interleukin 1 receptor-like 1 (IL1RL1), and interleukin 18 receptor 1 (IL18R1), form a cytokine receptor gene cluster in a region mapped to chromosome 2q12. [provided by RefSeq, Jul 2008]
Mouse(107527) interleukin 1 receptor-like 2
Rat(171106) interleukin 1 receptor-like 2
chicken(418716) interleukin 1 receptor-like 2
cow(522114) interleukin 1 receptor-like 2
domestic cat(101085113) interleukin 1 receptor-like 2
dog(611453) interleukin 1 receptor-like 2
sheep(101102800) interleukin 1 receptor-like 2
domestic guinea pig(100724483) interleukin 1 receptor-like 2
naked mole-rat(101720750) interleukin 1 receptor-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133193 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133193 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133193 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003854 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003854 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003854 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003854 Rosetta Predictions human pricing
NM_133575 Rosetta Predictions rat pricing
NM_133193 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233746 predicted 896
2 SASI_Hs01_00233747 predicted 1620
3 SASI_Hs01_00233748 predicted 1614
4 SASI_Hs01_00233749 predicted 437
5 SASI_Hs01_00233751 predicted 525
6 SASI_Hs01_00233752 predicted 426
7 SASI_Hs01_00233754 predicted 1203
8 SASI_Hs01_00233755 predicted 1233
9 SASI_Hs02_00336433 predicted 482
10 SASI_Hs02_00336434 predicted 1269
11 SASI_Hs01_00233750 predicted 1176
12 SASI_Hs01_00233753 predicted 1376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133575 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116017 predicted 628
2 SASI_Rn01_00116018 predicted 669
3 SASI_Rn01_00116019 predicted 213
4 SASI_Rn02_00267771 predicted 272
5 SASI_Rn01_00116020 predicted 1239
6 SASI_Rn01_00116021 predicted 1594
7 SASI_Rn02_00267772 predicted 953
8 SASI_Rn01_00116022 predicted 450
9 SASI_Rn01_00116024 predicted 343
10 SASI_Rn01_00116025 predicted 822
11 SASI_Rn01_00116023 predicted 983
12 SASI_Rn01_00116026 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133193 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175395 predicted 352
2 SASI_Mm01_00175396 predicted 1060
3 SASI_Mm01_00175397 predicted 1094
4 SASI_Mm01_00175398 predicted 1238
5 SASI_Mm01_00175399 predicted 593
6 SASI_Mm01_00175400 predicted 880
7 SASI_Mm01_00175401 predicted 1344
8 SASI_Mm01_00175403 predicted 1075
9 SASI_Mm02_00338375 predicted 511
10 SASI_Mm02_00338376 predicted 1705
11 SASI_Mm01_00175402 predicted 859
12 SASI_Mm01_00175404 predicted 214
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133193
IL1RL2 MISSION shRNA Bacterial Glycerol Stock
interleukin 1 receptor-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133193.1-891s1c1
Sequence:CCGGCCCTAACATCACGTATCCAAACTCGAGTTTGGATACGTGATGTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133193.1-598s1c1
Sequence:CCGGCCAGATGTGTACCAGCAAATACTCGAGTATTTGCTGGTACACATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133193.1-479s1c1
Sequence:CCGGCCGGTATCTATCAGTGTGTTACTCGAGTAACACACTGATAGATACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133193.1-1176s1c1
Sequence:CCGGCGCAGCCTACATCATTCTGATCTCGAGATCAGAATGATGTAGGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133193.1-907s1c1
Sequence:CCGGCCAAAGAACAACTCCATTGAACTCGAGTTCAATGGAGTTGTTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133193
IL1RL2 MISSION shRNA shRNA Plasmid DNA
interleukin 1 receptor-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133193.1-891s1c1
Sequence:CCGGCCCTAACATCACGTATCCAAACTCGAGTTTGGATACGTGATGTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133193.1-598s1c1
Sequence:CCGGCCAGATGTGTACCAGCAAATACTCGAGTATTTGCTGGTACACATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133193.1-479s1c1
Sequence:CCGGCCGGTATCTATCAGTGTGTTACTCGAGTAACACACTGATAGATACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133193.1-1176s1c1
Sequence:CCGGCGCAGCCTACATCATTCTGATCTCGAGATCAGAATGATGTAGGCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133193.1-907s1c1
Sequence:CCGGCCAAAGAACAACTCCATTGAACTCGAGTTCAATGGAGTTGTTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133193
IL1RL2 MISSION shRNA Lentiviral Transduction Particles
interleukin 1 receptor-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133193.1-891s1c1
Sequence:CCGGCCCTAACATCACGTATCCAAACTCGAGTTTGGATACGTGATGTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133193.1-598s1c1
Sequence:CCGGCCAGATGTGTACCAGCAAATACTCGAGTATTTGCTGGTACACATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133193.1-479s1c1
Sequence:CCGGCCGGTATCTATCAGTGTGTTACTCGAGTAACACACTGATAGATACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133193.1-1176s1c1
Sequence:CCGGCGCAGCCTACATCATTCTGATCTCGAGATCAGAATGATGTAGGCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133193.1-907s1c1
Sequence:CCGGCCAAAGAACAACTCCATTGAACTCGAGTTCAATGGAGTTGTTCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003854
IL1RL2 MISSION shRNA Bacterial Glycerol Stock
interleukin 1 receptor-like 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003854.2-1617s1c1
Sequence:CCGGGCCAGAGTCAATTCAGTACATCTCGAGATGTACTGAATTGACTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003854.2-1563s1c1
Sequence:CCGGCGGGATGAAGGTTATTCTCATCTCGAGATGAGAATAACCTTCATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003854.2-1805s1c1
Sequence:CCGGGCCCAGAACTAGGCTCAAGAACTCGAGTTCTTGAGCCTAGTTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003854.2-488s1c1
Sequence:CCGGCCATAGGTGGTTTACCAAATTCTCGAGAATTTGGTAAACCACCTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003854.2-431s1c1
Sequence:CCGGGCTGTCATAGAATACATGTAACTCGAGTTACATGTATTCTATGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003854.2-906s21c1
Sequence:CCGGACGATGCTGGAGAGTCAATAACTCGAGTTATTGACTCTCCAGCATCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003854.2-611s21c1
Sequence:CCGGATAAGGACTGTAACGAGATTACTCGAGTAATCTCGTTACAGTCCTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003854
IL1RL2 MISSION shRNA shRNA Plasmid DNA
interleukin 1 receptor-like 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003854.2-1617s1c1
Sequence:CCGGGCCAGAGTCAATTCAGTACATCTCGAGATGTACTGAATTGACTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003854.2-1563s1c1
Sequence:CCGGCGGGATGAAGGTTATTCTCATCTCGAGATGAGAATAACCTTCATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003854.2-1805s1c1
Sequence:CCGGGCCCAGAACTAGGCTCAAGAACTCGAGTTCTTGAGCCTAGTTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003854.2-488s1c1
Sequence:CCGGCCATAGGTGGTTTACCAAATTCTCGAGAATTTGGTAAACCACCTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003854.2-431s1c1
Sequence:CCGGGCTGTCATAGAATACATGTAACTCGAGTTACATGTATTCTATGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003854.2-906s21c1
Sequence:CCGGACGATGCTGGAGAGTCAATAACTCGAGTTATTGACTCTCCAGCATCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003854.2-611s21c1
Sequence:CCGGATAAGGACTGTAACGAGATTACTCGAGTAATCTCGTTACAGTCCTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003854
IL1RL2 MISSION shRNA Lentiviral Transduction Particles
interleukin 1 receptor-like 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003854.2-1617s1c1
Sequence:CCGGGCCAGAGTCAATTCAGTACATCTCGAGATGTACTGAATTGACTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003854.2-1563s1c1
Sequence:CCGGCGGGATGAAGGTTATTCTCATCTCGAGATGAGAATAACCTTCATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003854.2-1805s1c1
Sequence:CCGGGCCCAGAACTAGGCTCAAGAACTCGAGTTCTTGAGCCTAGTTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003854.2-488s1c1
Sequence:CCGGCCATAGGTGGTTTACCAAATTCTCGAGAATTTGGTAAACCACCTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003854.2-431s1c1
Sequence:CCGGGCTGTCATAGAATACATGTAACTCGAGTTACATGTATTCTATGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003854.2-906s21c1
Sequence:CCGGACGATGCTGGAGAGTCAATAACTCGAGTTATTGACTCTCCAGCATCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003854.2-611s21c1
Sequence:CCGGATAAGGACTGTAACGAGATTACTCGAGTAATCTCGTTACAGTCCTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)