EMAIL THIS PAGE TO A FRIEND

IL1RN

interleukin 1 receptor antagonist

161 Gene Product Result for
Synonyms: DIRA ICIL-1RA IL-1RN IL-1ra IL-1ra3 IL1F3 IL1RA IRAP MVCD4
Gene ID:
Human(3557) Summary: The protein encoded by this gene is a member of the interleukin 1 cytokine family. This protein inhibits the activities of interleukin 1, alpha (IL1A) and interleukin 1, beta (IL1B), and modulates a variety of interleukin 1 related immune and inflammatory responses. This gene and five other closely related cytokine genes form a gene cluster spanning approximately 400 kb on chromosome 2. A polymorphism of this gene is reported to be associated with increased risk of osteoporotic fractures and gastric cancer. Four alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(16181) interleukin 1 receptor antagonist
Rat(60582) interleukin 1 receptor antagonist
domestic guinea pig(100721865) interleukin 1 receptor antagonist
naked mole-rat(101706342) interleukin 1 receptor antagonist
sheep(780505) interleukin 1 receptor antagonist
Domestic Rabbit(100301539) interleukin 1 receptor antagonist
chicken(100861585) interleukin 1 receptor antagonist
cow(281860) interleukin 1 receptor antagonist
Horse(100034236) interleukin 1 receptor antagonist
dog(403660) interleukin 1 receptor antagonist
domestic cat(101096719) interleukin 1 receptor antagonist
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000577 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000577 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000577 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031167 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031167 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031167 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000577 Rosetta Predictions human pricing
NM_173841 Rosetta Predictions human pricing
NM_173842 Rosetta Predictions human pricing
NM_173843 Rosetta Predictions human pricing
NM_022194 Rosetta Predictions rat pricing
NM_001039701 Rosetta Predictions mouse pricing
NM_031167 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000577 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302836 predicted 432
2 SASI_Hs01_00067175 predicted 375
3 SASI_Hs01_00067176 predicted 567
4 SASI_Hs01_00067177 predicted 717
5 SASI_Hs01_00067178 predicted 803
6 SASI_Hs01_00067179 predicted 849
7 SASI_Hs01_00067181 predicted 352
8 SASI_Hs01_00067182 predicted 754
9 SASI_Hs01_00067184 predicted 343
10 SASI_Hs02_00302837 predicted 553
11 SASI_Hs01_00067180 predicted 795
12 SASI_Hs01_00067183 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368708 predicted 504
2 SASI_Hs01_00073531 predicted 434
3 SASI_Hs01_00073532 predicted 628
4 SASI_Hs01_00073533 predicted 787
5 SASI_Hs01_00073534 predicted 867
6 SASI_Hs01_00073535 predicted 914
7 SASI_Hs01_00073537 predicted 420
8 SASI_Hs01_00073538 predicted 815
9 SASI_Hs01_00073540 predicted 412
10 SASI_Hs02_00368709 predicted 610
11 SASI_Hs01_00073536 predicted 860
12 SASI_Hs01_00073539 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173842 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368710 predicted 430
2 SASI_Hs01_00204908 predicted 363
3 SASI_Hs01_00204909 predicted 551
4 SASI_Hs01_00204910 predicted 714
5 SASI_Hs01_00204911 predicted 796
6 SASI_Hs01_00204912 predicted 848
7 SASI_Hs01_00204914 predicted 342
8 SASI_Hs01_00204915 predicted 742
9 SASI_Hs01_00204917 predicted 341
10 SASI_Hs02_00368711 predicted 544
11 SASI_Hs01_00204913 predicted 787
12 SASI_Hs01_00204916 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142900 predicted 605
2 SASI_Hs01_00142901 predicted 543
3 SASI_Hs02_00368712 predicted 734
4 SASI_Hs02_00368713 predicted 897
5 SASI_Hs02_00368714 predicted 968
6 SASI_Hs02_00368715 predicted 1027
7 SASI_Hs01_00142906 predicted 527
8 SASI_Hs02_00368716 predicted 919
9 SASI_Hs02_00368717 predicted 512
10 SASI_Hs02_00368718 predicted 718
11 SASI_Hs01_00142902 predicted 521
12 SASI_Hs01_00142903 predicted 709
13 SASI_Hs01_00142904 predicted 554
14 SASI_Hs01_00142905 predicted 556
15 SASI_Hs01_00142907 predicted 579
16 SASI_Hs01_00142908 predicted 666
17 SASI_Hs01_00142909 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022194 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082926 predicted 432
2 SASI_Rn01_00082927 predicted 400
3 SASI_Rn01_00082928 predicted 370
4 SASI_Rn01_00082929 predicted 460
5 SASI_Rn01_00082930 predicted 409
6 SASI_Rn01_00082931 predicted 583
7 SASI_Rn01_00082933 predicted 221
8 SASI_Rn01_00082934 predicted 233
9 SASI_Rn01_00082935 predicted 209
10 SASI_Rn02_00262938 predicted 495
11 SASI_Rn01_00082932 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039701 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168061 predicted 461
2 SASI_Mm01_00168062 predicted 532
3 SASI_Mm01_00168063 predicted 539
4 SASI_Mm01_00168064 predicted 316
5 SASI_Mm01_00168065 predicted 402
6 SASI_Mm02_00290236 predicted 549
7 SASI_Mm01_00168066 predicted 641
8 SASI_Mm01_00168067 predicted 307
9 SASI_Mm01_00168068 predicted 319
10 SASI_Mm01_00168069 predicted 597
11 SASI_Mm01_00168070 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031167 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180027 predicted 489
2 SASI_Mm01_00180028 predicted 555
3 SASI_Mm01_00180029 predicted 568
4 SASI_Mm01_00180030 predicted 352
5 SASI_Mm01_00180031 predicted 429
6 SASI_Mm02_00336993 predicted 572
7 SASI_Mm01_00180032 predicted 680
8 SASI_Mm01_00180033 predicted 340
9 SASI_Mm01_00180034 predicted 347
10 SASI_Mm01_00180035 predicted 632
11 SASI_Mm01_00180036 predicted 345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000577
IL1RN MISSION shRNA Bacterial Glycerol Stock
interleukin 1 receptor antagonist
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000577.3-589s21c1
Sequence:CCGGTTCCAGGAGGACGAGTAGTACCTCGAGGTACTACTCGTCCTCCTGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000577.3-793s21c1
Sequence:CCGGCTGCCTCCAGAATGGTCTTTCCTCGAGGAAAGACCATTCTGGAGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000577.3-567s1c1
Sequence:CCGGCGTCATGGTCACCAAATTCTACTCGAGTAGAATTTGGTGACCATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000577.3-252s1c1
Sequence:CCGGGCAAGGACCAAATGTCAATTTCTCGAGAAATTGACATTTGGTCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000577.3-181s1c1
Sequence:CCGGGCCTTCAGAATCTGGGATGTTCTCGAGAACATCCCAGATTCTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000577.3-414s1c1
Sequence:CCGGCGAGAACAGAAAGCAGGACAACTCGAGTTGTCCTGCTTTCTGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000577.3-544s1c1
Sequence:CCGGCTCACCAATATGCCTGACGAACTCGAGTTCGTCAGGCATATTGGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000577.3-958s21c1
Sequence:CCGGGGATCCATCAGGCCACTTGATCTCGAGATCAAGTGGCCTGATGGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000577
IL1RN MISSION shRNA shRNA Plasmid DNA
interleukin 1 receptor antagonist
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000577.3-589s21c1
Sequence:CCGGTTCCAGGAGGACGAGTAGTACCTCGAGGTACTACTCGTCCTCCTGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000577.3-793s21c1
Sequence:CCGGCTGCCTCCAGAATGGTCTTTCCTCGAGGAAAGACCATTCTGGAGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000577.3-567s1c1
Sequence:CCGGCGTCATGGTCACCAAATTCTACTCGAGTAGAATTTGGTGACCATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000577.3-252s1c1
Sequence:CCGGGCAAGGACCAAATGTCAATTTCTCGAGAAATTGACATTTGGTCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000577.3-181s1c1
Sequence:CCGGGCCTTCAGAATCTGGGATGTTCTCGAGAACATCCCAGATTCTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000577.3-414s1c1
Sequence:CCGGCGAGAACAGAAAGCAGGACAACTCGAGTTGTCCTGCTTTCTGTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000577.3-544s1c1
Sequence:CCGGCTCACCAATATGCCTGACGAACTCGAGTTCGTCAGGCATATTGGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000577.3-958s21c1
Sequence:CCGGGGATCCATCAGGCCACTTGATCTCGAGATCAAGTGGCCTGATGGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000577
IL1RN MISSION shRNA Lentiviral Transduction Particles
interleukin 1 receptor antagonist
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000577.3-589s21c1
Sequence:CCGGTTCCAGGAGGACGAGTAGTACCTCGAGGTACTACTCGTCCTCCTGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000577.3-793s21c1
Sequence:CCGGCTGCCTCCAGAATGGTCTTTCCTCGAGGAAAGACCATTCTGGAGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000577.3-567s1c1
Sequence:CCGGCGTCATGGTCACCAAATTCTACTCGAGTAGAATTTGGTGACCATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000577.3-252s1c1
Sequence:CCGGGCAAGGACCAAATGTCAATTTCTCGAGAAATTGACATTTGGTCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000577.3-181s1c1
Sequence:CCGGGCCTTCAGAATCTGGGATGTTCTCGAGAACATCCCAGATTCTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000577.3-414s1c1
Sequence:CCGGCGAGAACAGAAAGCAGGACAACTCGAGTTGTCCTGCTTTCTGTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000577.3-544s1c1
Sequence:CCGGCTCACCAATATGCCTGACGAACTCGAGTTCGTCAGGCATATTGGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000577.3-958s21c1
Sequence:CCGGGGATCCATCAGGCCACTTGATCTCGAGATCAAGTGGCCTGATGGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031167
VALIDATED
IL1RN MISSION shRNA Bacterial Glycerol Stock
interleukin 1 receptor antagonist
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031167.5-216s21c1
Sequence:CCGGCCTGAGAAACAACCAGCTCATCTCGAGATGAGCTGGTTGTTTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031167.5-396s21c1
Sequence:CCGGCATCACTGATCTGAGCAAGAACTCGAGTTCTTGCTCAGATCAGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031167.5-287s21c1
Sequence:CCGGTGGTGCCTATTGACCTTCATACTCGAGTATGAAGGTCAATAGGCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031167.5-179s21c1
Sequence:CCGGCCTTCAGAATCTGGGATACTACTCGAGTAGTATCCCAGATTCTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031167.3-180s1c1
Sequence:CCGGCCTTCAGAATCTGGGATACTACTCGAGTAGTATCCCAGATTCTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031167.3-217s1c1
Sequence:CCGGCCTGAGAAACAACCAGCTCATCTCGAGATGAGCTGGTTGTTTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031167.3-565s1c1
Sequence:CCGGCCTTATAGTCACGAAGTTCTACTCGAGTAGAACTTCGTGACTATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031167.3-397s1c1
Sequence:CCGGCATCACTGATCTGAGCAAGAACTCGAGTTCTTGCTCAGATCAGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031167.3-288s1c1
Sequence:CCGGTGGTGCCTATTGACCTTCATACTCGAGTATGAAGGTCAATAGGCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031167.5-564s21c1
Sequence:CCGGCCTTATAGTCACGAAGTTCTACTCGAGTAGAACTTCGTGACTATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031167
VALIDATED
IL1RN MISSION shRNA shRNA Plasmid DNA
interleukin 1 receptor antagonist
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031167.5-216s21c1
Sequence:CCGGCCTGAGAAACAACCAGCTCATCTCGAGATGAGCTGGTTGTTTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031167.5-396s21c1
Sequence:CCGGCATCACTGATCTGAGCAAGAACTCGAGTTCTTGCTCAGATCAGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031167.5-287s21c1
Sequence:CCGGTGGTGCCTATTGACCTTCATACTCGAGTATGAAGGTCAATAGGCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031167.5-179s21c1
Sequence:CCGGCCTTCAGAATCTGGGATACTACTCGAGTAGTATCCCAGATTCTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031167.3-180s1c1
Sequence:CCGGCCTTCAGAATCTGGGATACTACTCGAGTAGTATCCCAGATTCTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031167.3-217s1c1
Sequence:CCGGCCTGAGAAACAACCAGCTCATCTCGAGATGAGCTGGTTGTTTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031167.3-565s1c1
Sequence:CCGGCCTTATAGTCACGAAGTTCTACTCGAGTAGAACTTCGTGACTATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031167.3-397s1c1
Sequence:CCGGCATCACTGATCTGAGCAAGAACTCGAGTTCTTGCTCAGATCAGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031167.3-288s1c1
Sequence:CCGGTGGTGCCTATTGACCTTCATACTCGAGTATGAAGGTCAATAGGCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031167.5-564s21c1
Sequence:CCGGCCTTATAGTCACGAAGTTCTACTCGAGTAGAACTTCGTGACTATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031167
VALIDATED
IL1RN MISSION shRNA Lentiviral Transduction Particles
interleukin 1 receptor antagonist
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031167.5-216s21c1
Sequence:CCGGCCTGAGAAACAACCAGCTCATCTCGAGATGAGCTGGTTGTTTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031167.5-396s21c1
Sequence:CCGGCATCACTGATCTGAGCAAGAACTCGAGTTCTTGCTCAGATCAGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031167.5-287s21c1
Sequence:CCGGTGGTGCCTATTGACCTTCATACTCGAGTATGAAGGTCAATAGGCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031167.5-179s21c1
Sequence:CCGGCCTTCAGAATCTGGGATACTACTCGAGTAGTATCCCAGATTCTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031167.3-180s1c1
Sequence:CCGGCCTTCAGAATCTGGGATACTACTCGAGTAGTATCCCAGATTCTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031167.3-217s1c1
Sequence:CCGGCCTGAGAAACAACCAGCTCATCTCGAGATGAGCTGGTTGTTTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031167.3-565s1c1
Sequence:CCGGCCTTATAGTCACGAAGTTCTACTCGAGTAGAACTTCGTGACTATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031167.3-397s1c1
Sequence:CCGGCATCACTGATCTGAGCAAGAACTCGAGTTCTTGCTCAGATCAGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031167.3-288s1c1
Sequence:CCGGTGGTGCCTATTGACCTTCATACTCGAGTATGAAGGTCAATAGGCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031167.5-564s21c1
Sequence:CCGGCCTTATAGTCACGAAGTTCTACTCGAGTAGAACTTCGTGACTATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)