EMAIL THIS PAGE TO A FRIEND

IL20RA

interleukin 20 receptor, alpha

97 Gene Product Result for
Synonyms: CRF2-8 IL-20R-alpha IL-20R1 IL-20RA
UniProtKB ID: Q9UHF4, Q14CW2, Q6UWA9, Q96SH8
Gene ID:
Human(53832) Summary: This gene encodes a member of the type II cytokine receptor family. The encoded protein is a subunit of the receptor for interleukin 20, a cytokine that may be involved in epidermal function. The interleukin 20 receptor is a heterodimeric complex consisting of the encoded protein and interleukin 20 receptor beta. This gene and interleukin 20 receptor beta are highly expressed in skin, and are upregulated in psoriasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(237313) interleukin 20 receptor, alpha
Rat(308716) interleukin 20 receptor, alpha
chicken(421686) interleukin 20 receptor, alpha
cow(509038) interleukin 20 receptor, alpha
domestic cat(101086565) interleukin 20 receptor, alpha
dog(484002) interleukin 20 receptor, alpha
sheep(101112653) interleukin 20 receptor, alpha
Domestic Rabbit(100341271) interleukin 20 receptor, alpha
domestic guinea pig(100723533) interleukin 20 receptor, alpha
naked mole-rat(101699117) interleukin 20 receptor, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014432 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014432 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014432 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172786 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172786 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172786 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014432 Rosetta Predictions human pricing
NM_001107521 Rosetta Predictions rat pricing
XM_218776 Rosetta Predictions rat pricing
NM_172786 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090589 predicted 1401
2 SASI_Hs01_00090590 predicted 984
3 SASI_Hs01_00090591 predicted 750
4 SASI_Hs01_00090592 predicted 1431
5 SASI_Hs01_00090593 predicted 1160
6 SASI_Hs01_00090594 predicted 1567
7 SASI_Hs01_00090595 predicted 1621
8 SASI_Hs01_00090596 predicted 1275
9 SASI_Hs01_00090597 predicted 1423
10 SASI_Hs01_00090598 predicted 1897
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107521 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229645 predicted 1044
2 SASI_Rn02_00229646 predicted 1506
3 SASI_Rn02_00229647 predicted 620
4 SASI_Rn02_00229648 predicted 1134
5 SASI_Rn02_00229649 predicted 302
6 SASI_Rn02_00229650 predicted 313
7 SASI_Rn02_00229651 predicted 980
8 SASI_Rn02_00229652 predicted 1018
9 SASI_Rn02_00229653 predicted 1486
10 SASI_Rn02_00229654 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218776 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00179176 predicted 940
2 SASI_Rn01_00179177 predicted 1004
3 SASI_Rn01_00179178 predicted 1073
4 SASI_Rn01_00179179 predicted 996
5 SASI_Rn01_00179180 predicted 912
6 SASI_Rn01_00179181 predicted 1184
7 SASI_Rn01_00179182 predicted 1090
8 SASI_Rn01_00179183 predicted 1198
9 SASI_Rn01_00179184 predicted 1051
10 SASI_Rn01_00179185 predicted 905
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172786 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063882 predicted 991
2 SASI_Mm01_00063883 predicted 255
3 SASI_Mm01_00063884 predicted 1138
4 SASI_Mm01_00063885 predicted 205
5 SASI_Mm01_00063887 predicted 229
6 SASI_Mm02_00344682 predicted 1746
7 SASI_Mm01_00063888 predicted 793
8 SASI_Mm01_00063890 predicted 811
9 SASI_Mm02_00344683 predicted 1023
10 SASI_Mm01_00063891 predicted 358
11 SASI_Mm01_00063886 predicted 875
12 SASI_Mm01_00063889 predicted 304
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014432
IL20RA MISSION shRNA Bacterial Glycerol Stock
interleukin 20 receptor, alpha
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014432.2-1205s1c1
Sequence:CCGGCCCGTATCTATTACCGTGTTTCTCGAGAAACACGGTAATAGATACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014432.2-1142s1c1
Sequence:CCGGGCCAGGACTTTGAAAGATCAACTCGAGTTGATCTTTCAAAGTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014432.2-751s1c1
Sequence:CCGGCCAGTATTATGCCAAAGTTAACTCGAGTTAACTTTGGCATAATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014432.2-1520s1c1
Sequence:CCGGGCTTCGCATTTGATGGAAATTCTCGAGAATTTCCATCAAATGCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014432.2-1371s1c1
Sequence:CCGGCCCTCAATATCTCGGATGATTCTCGAGAATCATCCGAGATATTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014432.2-611s21c1
Sequence:CCGGGAGGGTCTTCAAGGAGTTAAACTCGAGTTTAACTCCTTGAAGACCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014432.2-1763s21c1
Sequence:CCGGCAAACGTTACAGTACTCATACCTCGAGGTATGAGTACTGTAACGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014432.2-634s21c1
Sequence:CCGGTACTTACACTGTGCAGTATTTCTCGAGAAATACTGCACAGTGTAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014432
IL20RA MISSION shRNA shRNA Plasmid DNA
interleukin 20 receptor, alpha
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014432.2-1205s1c1
Sequence:CCGGCCCGTATCTATTACCGTGTTTCTCGAGAAACACGGTAATAGATACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014432.2-1142s1c1
Sequence:CCGGGCCAGGACTTTGAAAGATCAACTCGAGTTGATCTTTCAAAGTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014432.2-751s1c1
Sequence:CCGGCCAGTATTATGCCAAAGTTAACTCGAGTTAACTTTGGCATAATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014432.2-1520s1c1
Sequence:CCGGGCTTCGCATTTGATGGAAATTCTCGAGAATTTCCATCAAATGCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014432.2-1371s1c1
Sequence:CCGGCCCTCAATATCTCGGATGATTCTCGAGAATCATCCGAGATATTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014432.2-611s21c1
Sequence:CCGGGAGGGTCTTCAAGGAGTTAAACTCGAGTTTAACTCCTTGAAGACCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014432.2-1763s21c1
Sequence:CCGGCAAACGTTACAGTACTCATACCTCGAGGTATGAGTACTGTAACGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014432.2-634s21c1
Sequence:CCGGTACTTACACTGTGCAGTATTTCTCGAGAAATACTGCACAGTGTAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014432
IL20RA MISSION shRNA Lentiviral Transduction Particles
interleukin 20 receptor, alpha
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014432.2-1205s1c1
Sequence:CCGGCCCGTATCTATTACCGTGTTTCTCGAGAAACACGGTAATAGATACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014432.2-1142s1c1
Sequence:CCGGGCCAGGACTTTGAAAGATCAACTCGAGTTGATCTTTCAAAGTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014432.2-751s1c1
Sequence:CCGGCCAGTATTATGCCAAAGTTAACTCGAGTTAACTTTGGCATAATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014432.2-1520s1c1
Sequence:CCGGGCTTCGCATTTGATGGAAATTCTCGAGAATTTCCATCAAATGCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014432.2-1371s1c1
Sequence:CCGGCCCTCAATATCTCGGATGATTCTCGAGAATCATCCGAGATATTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014432.2-611s21c1
Sequence:CCGGGAGGGTCTTCAAGGAGTTAAACTCGAGTTTAACTCCTTGAAGACCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014432.2-1763s21c1
Sequence:CCGGCAAACGTTACAGTACTCATACCTCGAGGTATGAGTACTGTAACGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014432.2-634s21c1
Sequence:CCGGTACTTACACTGTGCAGTATTTCTCGAGAAATACTGCACAGTGTAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172786
IL20RA MISSION shRNA Bacterial Glycerol Stock
interleukin 20 receptor, alpha
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172786.1-1896s1c1
Sequence:CCGGGCTTTGTTGTAGACAGAGTAACTCGAGTTACTCTGTCTACAACAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172786.1-1528s1c1
Sequence:CCGGCCTGAGAACTATGGTCATTATCTCGAGATAATGACCATAGTTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172786.1-175s1c1
Sequence:CCGGCCTACAAATATCACCTTCTTACTCGAGTAAGAAGGTGATATTTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172786.1-375s1c1
Sequence:CCGGCCAGTTCTATGCCAAAGTGAACTCGAGTTCACTTTGGCATAGAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172786.1-910s1c1
Sequence:CCGGCCAGCAAATTTGGTACTGATTCTCGAGAATCAGTACCAAATTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172786.2-243s21c1
Sequence:CCGGCACGGAGTTGAAGTCACATACCTCGAGGTATGTGACTTCAACTCCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172786.2-965s21c1
Sequence:CCGGTACTGAAACAATCACACTTAACTCGAGTTAAGTGTGATTGTTTCAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172786.2-306s21c1
Sequence:CCGGGCCTCTAAATGCGGGAGTATCCTCGAGGATACTCCCGCATTTAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172786.2-496s21c1
Sequence:CCGGGCGAGAAGTCCATCTCTATTGCTCGAGCAATAGAGATGGACTTCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172786
IL20RA MISSION shRNA shRNA Plasmid DNA
interleukin 20 receptor, alpha
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172786.1-1896s1c1
Sequence:CCGGGCTTTGTTGTAGACAGAGTAACTCGAGTTACTCTGTCTACAACAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172786.1-1528s1c1
Sequence:CCGGCCTGAGAACTATGGTCATTATCTCGAGATAATGACCATAGTTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172786.1-175s1c1
Sequence:CCGGCCTACAAATATCACCTTCTTACTCGAGTAAGAAGGTGATATTTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172786.1-375s1c1
Sequence:CCGGCCAGTTCTATGCCAAAGTGAACTCGAGTTCACTTTGGCATAGAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172786.1-910s1c1
Sequence:CCGGCCAGCAAATTTGGTACTGATTCTCGAGAATCAGTACCAAATTTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172786.2-243s21c1
Sequence:CCGGCACGGAGTTGAAGTCACATACCTCGAGGTATGTGACTTCAACTCCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172786.2-965s21c1
Sequence:CCGGTACTGAAACAATCACACTTAACTCGAGTTAAGTGTGATTGTTTCAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172786.2-306s21c1
Sequence:CCGGGCCTCTAAATGCGGGAGTATCCTCGAGGATACTCCCGCATTTAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172786.2-496s21c1
Sequence:CCGGGCGAGAAGTCCATCTCTATTGCTCGAGCAATAGAGATGGACTTCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172786
IL20RA MISSION shRNA Lentiviral Transduction Particles
interleukin 20 receptor, alpha
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172786.1-1896s1c1
Sequence:CCGGGCTTTGTTGTAGACAGAGTAACTCGAGTTACTCTGTCTACAACAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172786.1-1528s1c1
Sequence:CCGGCCTGAGAACTATGGTCATTATCTCGAGATAATGACCATAGTTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172786.1-175s1c1
Sequence:CCGGCCTACAAATATCACCTTCTTACTCGAGTAAGAAGGTGATATTTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172786.1-375s1c1
Sequence:CCGGCCAGTTCTATGCCAAAGTGAACTCGAGTTCACTTTGGCATAGAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172786.1-910s1c1
Sequence:CCGGCCAGCAAATTTGGTACTGATTCTCGAGAATCAGTACCAAATTTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172786.2-243s21c1
Sequence:CCGGCACGGAGTTGAAGTCACATACCTCGAGGTATGTGACTTCAACTCCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172786.2-965s21c1
Sequence:CCGGTACTGAAACAATCACACTTAACTCGAGTTAAGTGTGATTGTTTCAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172786.2-306s21c1
Sequence:CCGGGCCTCTAAATGCGGGAGTATCCTCGAGGATACTCCCGCATTTAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172786.2-496s21c1
Sequence:CCGGGCGAGAAGTCCATCTCTATTGCTCGAGCAATAGAGATGGACTTCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)