EMAIL THIS PAGE TO A FRIEND

IL20RB

interleukin 20 receptor beta

76 Gene Product Result for
Synonyms: DIRS1 FNDC6 IL-20R2
UniProtKB ID: Q6UXL0, B4DL40, Q6P438, Q8TAJ7
Gene ID:
Human(53833) Summary: IL20RB and IL20RA (MIM 605620) form a heterodimeric receptor for interleukin-20 (IL20; MIM 605619) (Blumberg et al., 2001 [PubMed 11163236]
Mouse(213208) interleukin 20 receptor beta
Rat(501043) interleukin 20 receptor beta
domestic guinea pig(100724966) interleukin 20 receptor beta
naked mole-rat(101721740) interleukin 20 receptor beta
sheep(101113034) interleukin 20 receptor beta
chicken(768437) interleukin 20 receptor beta
domestic cat(101081159) interleukin 20 receptor beta
dog(610961) interleukin 20 receptor beta
cow(534581) interleukin 20 receptor beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033543 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033543 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033543 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001037246 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001037246 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001037246 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144717 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144717 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144717 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144717 Rosetta Predictions human pricing
XM_001071171 Rosetta Predictions rat pricing
XM_576456 Rosetta Predictions rat pricing
NM_001033543 Rosetta Predictions mouse pricing
NM_001037246 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158574 predicted 691
2 SASI_Hs01_00158575 predicted 357
3 SASI_Hs01_00158576 predicted 619
4 SASI_Hs01_00158577 predicted 851
5 SASI_Hs01_00158578 predicted 252
6 SASI_Hs01_00158579 predicted 583
7 SASI_Hs01_00158580 predicted 840
8 SASI_Hs01_00158581 predicted 1679
9 SASI_Hs02_00364658 predicted 882
10 SASI_Hs01_00158583 predicted 515
11 SASI_Hs01_00158582 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071171 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334084 predicted 1099
2 SASI_Rn02_00334085 predicted 414
3 SASI_Rn02_00334086 predicted 936
4 SASI_Rn02_00334087 predicted 1570
5 SASI_Rn02_00334088 predicted 533
6 SASI_Rn02_00334089 predicted 1431
7 SASI_Rn02_00334090 predicted 994
8 SASI_Rn02_00334091 predicted 495
9 SASI_Rn02_00334092 predicted 1380
10 SASI_Rn02_00334093 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576456 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405383 predicted 408
2 SASI_Rn02_00405384 predicted 259
3 SASI_Rn02_00405385 predicted 539
4 SASI_Rn02_00405386 predicted 499
5 SASI_Rn02_00405387 predicted 493
6 SASI_Rn02_00405388 predicted 357
7 SASI_Rn02_00405389 predicted 709
8 SASI_Rn02_00405390 predicted 246
9 SASI_Rn02_00405391 predicted 505
10 SASI_Rn02_00405392 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033543 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140100 predicted 1497
2 SASI_Mm02_00288914 predicted 317
3 SASI_Mm01_00140104 predicted 855
4 SASI_Mm02_00288915 predicted 560
5 SASI_Mm01_00140106 predicted 1169
6 SASI_Mm02_00288916 predicted 1058
7 SASI_Mm02_00288917 predicted 234
8 SASI_Mm02_00288918 predicted 351
9 SASI_Mm02_00288919 predicted 733
10 SASI_Mm02_00288920 predicted 841
11 SASI_Mm01_00140099 predicted 1264
12 SASI_Mm01_00140101 predicted 639
13 SASI_Mm01_00140102 predicted 1093
14 SASI_Mm01_00140103 predicted 817
15 SASI_Mm01_00140105 predicted 1131
16 SASI_Mm01_00140107 predicted 1405
17 SASI_Mm01_00140108 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037246 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053327 predicted 711
2 SASI_Mm01_00053328 predicted 325
3 SASI_Mm01_00053329 predicted 705
4 SASI_Mm01_00053330 predicted 264
5 SASI_Mm01_00053331 predicted 711
6 SASI_Mm01_00053332 predicted 238
7 SASI_Mm01_00053333 predicted 475
8 SASI_Mm01_00053334 predicted 362
9 SASI_Mm01_00053335 predicted 256
10 SASI_Mm01_00053336 predicted 768
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033543
IL20RB MISSION shRNA Bacterial Glycerol Stock
interleukin 20 receptor beta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033543.3-691s21c1
Sequence:CCGGCATTCCGGTGCACCTAGAAACCTCGAGGTTTCTAGGTGCACCGGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033543.3-1072s21c1
Sequence:CCGGAGAAGGACCTGATGGATTAACCTCGAGGTTAATCCATCAGGTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033543.3-440s21c1
Sequence:CCGGACCGCCACAGTGCCATATAACCTCGAGGTTATATGGCACTGTGGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033543.3-1596s21c1
Sequence:CCGGCCGAACAACCAAGAGTAATAACTCGAGTTATTACTCTTGGTTGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033543.3-572s21c1
Sequence:CCGGCATGGGCTGCATCTGGTTATTCTCGAGAATAACCAGATGCAGCCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033543
IL20RB MISSION shRNA shRNA Plasmid DNA
interleukin 20 receptor beta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033543.3-691s21c1
Sequence:CCGGCATTCCGGTGCACCTAGAAACCTCGAGGTTTCTAGGTGCACCGGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033543.3-1072s21c1
Sequence:CCGGAGAAGGACCTGATGGATTAACCTCGAGGTTAATCCATCAGGTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033543.3-440s21c1
Sequence:CCGGACCGCCACAGTGCCATATAACCTCGAGGTTATATGGCACTGTGGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033543.3-1596s21c1
Sequence:CCGGCCGAACAACCAAGAGTAATAACTCGAGTTATTACTCTTGGTTGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033543.3-572s21c1
Sequence:CCGGCATGGGCTGCATCTGGTTATTCTCGAGAATAACCAGATGCAGCCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033543
IL20RB MISSION shRNA Lentiviral Transduction Particles
interleukin 20 receptor beta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033543.3-691s21c1
Sequence:CCGGCATTCCGGTGCACCTAGAAACCTCGAGGTTTCTAGGTGCACCGGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033543.3-1072s21c1
Sequence:CCGGAGAAGGACCTGATGGATTAACCTCGAGGTTAATCCATCAGGTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033543.3-440s21c1
Sequence:CCGGACCGCCACAGTGCCATATAACCTCGAGGTTATATGGCACTGTGGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033543.3-1596s21c1
Sequence:CCGGCCGAACAACCAAGAGTAATAACTCGAGTTATTACTCTTGGTTGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033543.3-572s21c1
Sequence:CCGGCATGGGCTGCATCTGGTTATTCTCGAGAATAACCAGATGCAGCCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037246
IL20RB MISSION shRNA Bacterial Glycerol Stock
interleukin 20 receptor beta
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000173716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037246.1-849s1c1
Sequence:CCGGCTTGGTGGGTTCTAAGGTAAACTCGAGTTTACCTTAGAACCCACCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037246.1-572s1c1
Sequence:CCGGCGGAACATGTTAAGATGGTGACTCGAGTCACCATCTTAACATGTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001037246.1-1010s1c1
Sequence:CCGGGAGACACCACACTGTATAATACTCGAGTATTATACAGTGTGGTGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037246
IL20RB MISSION shRNA shRNA Plasmid DNA
interleukin 20 receptor beta
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000173716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037246.1-849s1c1
Sequence:CCGGCTTGGTGGGTTCTAAGGTAAACTCGAGTTTACCTTAGAACCCACCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037246.1-572s1c1
Sequence:CCGGCGGAACATGTTAAGATGGTGACTCGAGTCACCATCTTAACATGTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001037246.1-1010s1c1
Sequence:CCGGGAGACACCACACTGTATAATACTCGAGTATTATACAGTGTGGTGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037246
IL20RB MISSION shRNA Lentiviral Transduction Particles
interleukin 20 receptor beta
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000173716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037246.1-849s1c1
Sequence:CCGGCTTGGTGGGTTCTAAGGTAAACTCGAGTTTACCTTAGAACCCACCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037246.1-572s1c1
Sequence:CCGGCGGAACATGTTAAGATGGTGACTCGAGTCACCATCTTAACATGTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001037246.1-1010s1c1
Sequence:CCGGGAGACACCACACTGTATAATACTCGAGTATTATACAGTGTGGTGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144717
IL20RB MISSION shRNA Bacterial Glycerol Stock
interleukin 20 receptor beta
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149761    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144717.2-1730s1c1
Sequence:CCGGGCAATGGTGTTGAGTTCACTTCTCGAGAAGTGAACTCAACACCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144717.2-1694s1c1
Sequence:CCGGCCCAGAATAATCCTTGAGAGACTCGAGTCTCTCAAGGATTATTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144717.2-1695s1c1
Sequence:CCGGCCAGAATAATCCTTGAGAGAACTCGAGTTCTCTCAAGGATTATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144717.2-312s1c1
Sequence:CCGGCGCATTGATTCCATGTTTGCTCTCGAGAGCAAACATGGAATCAATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144717.2-372s1c1
Sequence:CCGGCTCTGTACTCTCAACCAACATCTCGAGATGTTGGTTGAGAGTACAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144717.2-437s1c1
Sequence:CCGGCAGTGTACTATTCTGTCGAATCTCGAGATTCGACAGAATAGTACACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144717
IL20RB MISSION shRNA shRNA Plasmid DNA
interleukin 20 receptor beta
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149761    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144717.2-1730s1c1
Sequence:CCGGGCAATGGTGTTGAGTTCACTTCTCGAGAAGTGAACTCAACACCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144717.2-1694s1c1
Sequence:CCGGCCCAGAATAATCCTTGAGAGACTCGAGTCTCTCAAGGATTATTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144717.2-1695s1c1
Sequence:CCGGCCAGAATAATCCTTGAGAGAACTCGAGTTCTCTCAAGGATTATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144717.2-312s1c1
Sequence:CCGGCGCATTGATTCCATGTTTGCTCTCGAGAGCAAACATGGAATCAATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144717.2-372s1c1
Sequence:CCGGCTCTGTACTCTCAACCAACATCTCGAGATGTTGGTTGAGAGTACAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144717.2-437s1c1
Sequence:CCGGCAGTGTACTATTCTGTCGAATCTCGAGATTCGACAGAATAGTACACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144717
IL20RB MISSION shRNA Lentiviral Transduction Particles
interleukin 20 receptor beta
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149761    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144717.2-1730s1c1
Sequence:CCGGGCAATGGTGTTGAGTTCACTTCTCGAGAAGTGAACTCAACACCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144717.2-1694s1c1
Sequence:CCGGCCCAGAATAATCCTTGAGAGACTCGAGTCTCTCAAGGATTATTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144717.2-1695s1c1
Sequence:CCGGCCAGAATAATCCTTGAGAGAACTCGAGTTCTCTCAAGGATTATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144717.2-312s1c1
Sequence:CCGGCGCATTGATTCCATGTTTGCTCTCGAGAGCAAACATGGAATCAATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144717.2-372s1c1
Sequence:CCGGCTCTGTACTCTCAACCAACATCTCGAGATGTTGGTTGAGAGTACAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144717.2-437s1c1
Sequence:CCGGCAGTGTACTATTCTGTCGAATCTCGAGATTCGACAGAATAGTACACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)