EMAIL THIS PAGE TO A FRIEND

IL21

interleukin 21

84 Gene Product Result for
Synonyms: IL-21 Za11
UniProtKB ID: Q9HBE4, A5J0L4
Gene ID:
Human(59067) Summary: This gene encodes a member of the common-gamma chain family of cytokines with immunoregulatory activity. The encoded protein plays a role in both the innate and adaptive immune responses by inducing the differentiation, proliferation and activity of multiple target cells including macrophages, natural killer cells, B cells and cytotoxic T cells. Dysregulation of this gene plays a role in multiple immune-mediated diseases including lupus, psoriasis and chronic inflammatory diseases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Mouse(60505) interleukin 21
Rat(365769) interleukin 21
Zebrafish(100150203) interleukin 21
chicken(554218) interleukin 21
cow(378475) interleukin 21
domestic cat(101087399) interleukin 21
dog(442935) interleukin 21
Goat(100861248) interleukin 21
sheep(100862657) interleukin 21
naked mole-rat(101720915) interleukin 21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021803 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021803 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021803 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021782 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021782 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021782 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021803 Rosetta Predictions human pricing
NM_001108943 Rosetta Predictions rat pricing
NM_021782 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150865 predicted 413
2 SASI_Hs01_00150866 predicted 392
3 SASI_Hs01_00150867 predicted 232
4 SASI_Hs01_00150868 predicted 300
5 SASI_Hs01_00150869 predicted 245
6 SASI_Hs01_00150870 predicted 409
7 SASI_Hs01_00150871 predicted 299
8 SASI_Hs01_00150872 predicted 317
9 SASI_Hs01_00150873 predicted 322
10 SASI_Hs02_00355106 predicted 309
11 SASI_Hs01_00150874 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108943 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243614 predicted 294
2 SASI_Rn02_00243615 predicted 333
3 SASI_Rn02_00243616 predicted 102
4 SASI_Rn02_00243617 predicted 140
5 SASI_Rn02_00243618 predicted 69
6 SASI_Rn02_00243619 predicted 240
7 SASI_Rn02_00243620 predicted 129
8 SASI_Rn02_00243621 predicted 82
9 SASI_Rn02_00243622 predicted 367
10 SASI_Rn02_00243623 predicted 88
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021782 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128658 predicted 899
2 SASI_Mm01_00128659 predicted 657
3 SASI_Mm01_00128660 predicted 764
4 SASI_Mm01_00128661 predicted 293
5 SASI_Mm02_00326420 predicted 300
6 SASI_Mm02_00326421 predicted 281
7 SASI_Mm01_00128662 predicted 686
8 SASI_Mm01_00128663 predicted 809
9 SASI_Mm01_00128664 predicted 686
10 SASI_Mm01_00128665 predicted 676
11 SASI_Mm01_00128666 predicted 561
12 SASI_Mm01_00128667 predicted 619
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021803
IL21 MISSION shRNA Bacterial Glycerol Stock
interleukin 21
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021803.1-440s1c1
Sequence:CCGGCCACCCAAAGAATTCCTAGAACTCGAGTTCTAGGAATTCTTTGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021803.1-462s1c1
Sequence:CCGGGATTCAAATCACTTCTCCAAACTCGAGTTTGGAGAAGTGATTTGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021803.1-159s1c1
Sequence:CCGGGAATGCGTCAACTTATAGATACTCGAGTATCTATAAGTTGACGCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021803.1-176s1c1
Sequence:CCGGGATATTGTTGATCAGCTGAAACTCGAGTTTCAGCTGATCAACAATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021803.1-302s1c1
Sequence:CCGGTCAGCAAATACAGGAAACAATCTCGAGATTGTTTCCTGTATTTGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021803.2-279s21c1
Sequence:CCGGCTTTCAGAAGGCCCAACTAAACTCGAGTTTAGTTGGGCCTTCTGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021803.2-358s21c1
Sequence:CCGGAGGAAACCACCTTCCACAAATCTCGAGATTTGTGGAAGGTGGTTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021803.2-206s21c1
Sequence:CCGGATGACTTGGTCCCTGAATTTCCTCGAGGAAATTCAGGGACCAAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021803
IL21 MISSION shRNA shRNA Plasmid DNA
interleukin 21
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021803.1-440s1c1
Sequence:CCGGCCACCCAAAGAATTCCTAGAACTCGAGTTCTAGGAATTCTTTGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021803.1-462s1c1
Sequence:CCGGGATTCAAATCACTTCTCCAAACTCGAGTTTGGAGAAGTGATTTGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021803.1-159s1c1
Sequence:CCGGGAATGCGTCAACTTATAGATACTCGAGTATCTATAAGTTGACGCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021803.1-176s1c1
Sequence:CCGGGATATTGTTGATCAGCTGAAACTCGAGTTTCAGCTGATCAACAATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021803.1-302s1c1
Sequence:CCGGTCAGCAAATACAGGAAACAATCTCGAGATTGTTTCCTGTATTTGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021803.2-279s21c1
Sequence:CCGGCTTTCAGAAGGCCCAACTAAACTCGAGTTTAGTTGGGCCTTCTGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021803.2-358s21c1
Sequence:CCGGAGGAAACCACCTTCCACAAATCTCGAGATTTGTGGAAGGTGGTTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021803.2-206s21c1
Sequence:CCGGATGACTTGGTCCCTGAATTTCCTCGAGGAAATTCAGGGACCAAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021803
IL21 MISSION shRNA Lentiviral Transduction Particles
interleukin 21
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021803.1-440s1c1
Sequence:CCGGCCACCCAAAGAATTCCTAGAACTCGAGTTCTAGGAATTCTTTGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021803.1-462s1c1
Sequence:CCGGGATTCAAATCACTTCTCCAAACTCGAGTTTGGAGAAGTGATTTGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021803.1-159s1c1
Sequence:CCGGGAATGCGTCAACTTATAGATACTCGAGTATCTATAAGTTGACGCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021803.1-176s1c1
Sequence:CCGGGATATTGTTGATCAGCTGAAACTCGAGTTTCAGCTGATCAACAATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021803.1-302s1c1
Sequence:CCGGTCAGCAAATACAGGAAACAATCTCGAGATTGTTTCCTGTATTTGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021803.2-279s21c1
Sequence:CCGGCTTTCAGAAGGCCCAACTAAACTCGAGTTTAGTTGGGCCTTCTGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021803.2-358s21c1
Sequence:CCGGAGGAAACCACCTTCCACAAATCTCGAGATTTGTGGAAGGTGGTTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021803.2-206s21c1
Sequence:CCGGATGACTTGGTCCCTGAATTTCCTCGAGGAAATTCAGGGACCAAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021782
IL21 MISSION shRNA Bacterial Glycerol Stock
interleukin 21
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021782.1-676s1c1
Sequence:CCGGCCCATTAACTAAGCAGACATTCTCGAGAATGTCTGCTTAGTTAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021782.1-296s1c1
Sequence:CCGGCCCTGGAAACAATAAGACATTCTCGAGAATGTCTTATTGTTTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021782.1-287s1c1
Sequence:CCGGGCCATCAAACCCTGGAAACAACTCGAGTTGTTTCCAGGGTTTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021782.1-402s1c1
Sequence:CCGGTCCTGTGATTCGTATGAGAAACTCGAGTTTCTCATACGAATCACAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021782.1-139s1c1
Sequence:CCGGTGATTAGACTTCGTCACCTTACTCGAGTAAGGTGACGAAGTCTAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021782.2-496s21c1
Sequence:CCGGACACATAGGACCCGAAGATTCCTCGAGGAATCTTCGGGTCCTATGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021782.2-614s21c1
Sequence:CCGGGGAGAAGTACGATACGTTATGCTCGAGCATAACGTATCGTACTTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021782
IL21 MISSION shRNA shRNA Plasmid DNA
interleukin 21
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021782.1-676s1c1
Sequence:CCGGCCCATTAACTAAGCAGACATTCTCGAGAATGTCTGCTTAGTTAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021782.1-296s1c1
Sequence:CCGGCCCTGGAAACAATAAGACATTCTCGAGAATGTCTTATTGTTTCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021782.1-287s1c1
Sequence:CCGGGCCATCAAACCCTGGAAACAACTCGAGTTGTTTCCAGGGTTTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021782.1-402s1c1
Sequence:CCGGTCCTGTGATTCGTATGAGAAACTCGAGTTTCTCATACGAATCACAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021782.1-139s1c1
Sequence:CCGGTGATTAGACTTCGTCACCTTACTCGAGTAAGGTGACGAAGTCTAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021782.2-496s21c1
Sequence:CCGGACACATAGGACCCGAAGATTCCTCGAGGAATCTTCGGGTCCTATGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021782.2-614s21c1
Sequence:CCGGGGAGAAGTACGATACGTTATGCTCGAGCATAACGTATCGTACTTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021782
IL21 MISSION shRNA Lentiviral Transduction Particles
interleukin 21
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021782.1-676s1c1
Sequence:CCGGCCCATTAACTAAGCAGACATTCTCGAGAATGTCTGCTTAGTTAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021782.1-296s1c1
Sequence:CCGGCCCTGGAAACAATAAGACATTCTCGAGAATGTCTTATTGTTTCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021782.1-287s1c1
Sequence:CCGGGCCATCAAACCCTGGAAACAACTCGAGTTGTTTCCAGGGTTTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021782.1-402s1c1
Sequence:CCGGTCCTGTGATTCGTATGAGAAACTCGAGTTTCTCATACGAATCACAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021782.1-139s1c1
Sequence:CCGGTGATTAGACTTCGTCACCTTACTCGAGTAAGGTGACGAAGTCTAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021782.2-496s21c1
Sequence:CCGGACACATAGGACCCGAAGATTCCTCGAGGAATCTTCGGGTCCTATGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021782.2-614s21c1
Sequence:CCGGGGAGAAGTACGATACGTTATGCTCGAGCATAACGTATCGTACTTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)