EMAIL THIS PAGE TO A FRIEND

IL21R

interleukin 21 receptor

84 Gene Product Result for
Synonyms: CD360 NILR
UniProtKB ID: Q9HBE5, A8K9E8, D3DWF7, Q96HZ1, Q9HB91
Gene ID:
Human(50615) Summary: The protein encoded by this gene is a cytokine receptor for interleukin 21 (IL21). It belongs to the type I cytokine receptors, and has been shown to form a heterodimeric receptor complex with the common gamma-chain, a receptor subunit also shared by the receptors for interleukin 2, 4, 7, 9, and 15. This receptor transduces the growth promoting signal of IL21, and is important for the proliferation and differentiation of T cells, B cells, and natural killer (NK) cells. The ligand binding of this receptor leads to the activation of multiple downstream signaling molecules, including JAK1, JAK3, STAT1, and STAT3. Knockout studies of a similar gene in mouse suggest a role for this gene in regulating immunoglobulin production. Three alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]
Mouse(60504) interleukin 21 receptor
Rat(308977) interleukin 21 receptor
Zebrafish(100134976) interleukin 21 receptor
cow(617967) interleukin 21 receptor
Horse(100066814) interleukin 21 receptor
domestic cat(101096026) interleukin 21 receptor
dog(608011) interleukin 21 receptor
chicken(416586) interleukin 21 receptor
domestic guinea pig(100721842) interleukin 21 receptor
naked mole-rat(101701307) interleukin 21 receptor
sheep(100820753) interleukin 21 receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0696 Human IL21R / Interleukin-21 Receptor ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181079 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181079 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181079 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021887 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021887 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021887 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU064191 MISSION® esiRNA esiRNA human IL21R (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021798 Rosetta Predictions human pricing
NM_181078 Rosetta Predictions human pricing
NM_181079 Rosetta Predictions human pricing
NM_001012469 Rosetta Predictions rat pricing
NM_021887 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355099 predicted 442
2 SASI_Hs01_00037179 predicted 888
3 SASI_Hs01_00037180 predicted 394
4 SASI_Hs01_00037181 predicted 1445
5 SASI_Hs01_00037182 predicted 877
6 SASI_Hs01_00037184 predicted 636
7 SASI_Hs01_00037185 predicted 1248
8 SASI_Hs02_00355100 predicted 771
9 SASI_Hs01_00037186 predicted 1226
10 SASI_Hs01_00037187 predicted 1392
11 SASI_Hs01_00037183 predicted 800
12 SASI_Hs01_00037188 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369935 predicted 560
2 SASI_Hs01_00066407 predicted 998
3 SASI_Hs01_00066408 predicted 508
4 SASI_Hs01_00066409 predicted 1560
5 SASI_Hs01_00066410 predicted 990
6 SASI_Hs01_00066412 predicted 751
7 SASI_Hs01_00066413 predicted 1360
8 SASI_Hs02_00369936 predicted 888
9 SASI_Hs01_00066414 predicted 1332
10 SASI_Hs01_00066415 predicted 1502
11 SASI_Hs01_00066411 predicted 921
12 SASI_Hs01_00066416 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369937 predicted 456
2 SASI_Hs01_00188641 predicted 898
3 SASI_Hs01_00188642 predicted 413
4 SASI_Hs01_00188643 predicted 1461
5 SASI_Hs01_00188644 predicted 888
6 SASI_Hs01_00188646 predicted 647
7 SASI_Hs01_00188647 predicted 1259
8 SASI_Hs02_00369938 predicted 786
9 SASI_Hs01_00188648 predicted 1237
10 SASI_Hs01_00188649 predicted 1407
11 SASI_Hs01_00188645 predicted 825
12 SASI_Hs01_00188650 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012469 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114918 predicted 585
2 SASI_Rn01_00114919 predicted 745
3 SASI_Rn01_00114920 predicted 899
4 SASI_Rn01_00114921 predicted 743
5 SASI_Rn01_00114922 predicted 1582
6 SASI_Rn01_00114923 predicted 1355
7 SASI_Rn02_00200575 predicted 1026
8 SASI_Rn01_00114924 predicted 1363
9 SASI_Rn01_00114925 predicted 760
10 SASI_Rn01_00114926 predicted 1579
11 SASI_Rn01_00114927 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090282 predicted 629
2 SASI_Mm01_00090283 predicted 1326
3 SASI_Mm01_00090284 predicted 629
4 SASI_Mm01_00090285 predicted 467
5 SASI_Mm02_00326450 predicted 778
6 SASI_Mm01_00090286 predicted 1325
7 SASI_Mm01_00090287 predicted 1483
8 SASI_Mm01_00090288 predicted 1243
9 SASI_Mm01_00090289 predicted 1284
10 SASI_Mm01_00090290 predicted 645
11 SASI_Mm01_00090291 predicted 644
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181079
IL21R MISSION shRNA Bacterial Glycerol Stock
interleukin 21 receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181079.1-201s21c1
Sequence:CCGGCCTCGTCTGCTACACCGATTACTCGAGTAATCGGTGTAGCAGACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181079.1-2244s21c1
Sequence:CCGGAGCTGCAAGAAGTCCATATTGCTCGAGCAATATGGACTTCTTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181079.1-807s21c1
Sequence:CCGGGACCCAGTCAGAGGAGTTAAACTCGAGTTTAACTCCTCTGACTGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181079.1-395s21c1
Sequence:CCGGACTTCATGGCCGACGACATTTCTCGAGAAATGTCGTCGGCCATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181079.1-1597s1c1
Sequence:CCGGGACACGTTTGACAGTGGCTTTCTCGAGAAAGCCACTGTCAAACGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181079.1-381s1c1
Sequence:CCGGCATGGATGTATTCCACTTCATCTCGAGATGAAGTGGAATACATCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181079.1-858s1c1
Sequence:CCGGCCTCCTGCTTGTCATAGTCTTCTCGAGAAGACTATGACAAGCAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181079.1-990s1c1
Sequence:CCGGCGGAGACTTCAAGAAATGGGTCTCGAGACCCATTTCTTGAAGTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181079.1-567s1c1
Sequence:CCGGCCCTGCCTTCTACATGCTGAACTCGAGTTCAGCATGTAGAAGGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181079
IL21R MISSION shRNA shRNA Plasmid DNA
interleukin 21 receptor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181079.1-201s21c1
Sequence:CCGGCCTCGTCTGCTACACCGATTACTCGAGTAATCGGTGTAGCAGACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181079.1-2244s21c1
Sequence:CCGGAGCTGCAAGAAGTCCATATTGCTCGAGCAATATGGACTTCTTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181079.1-807s21c1
Sequence:CCGGGACCCAGTCAGAGGAGTTAAACTCGAGTTTAACTCCTCTGACTGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181079.1-395s21c1
Sequence:CCGGACTTCATGGCCGACGACATTTCTCGAGAAATGTCGTCGGCCATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181079.1-1597s1c1
Sequence:CCGGGACACGTTTGACAGTGGCTTTCTCGAGAAAGCCACTGTCAAACGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181079.1-381s1c1
Sequence:CCGGCATGGATGTATTCCACTTCATCTCGAGATGAAGTGGAATACATCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181079.1-858s1c1
Sequence:CCGGCCTCCTGCTTGTCATAGTCTTCTCGAGAAGACTATGACAAGCAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181079.1-990s1c1
Sequence:CCGGCGGAGACTTCAAGAAATGGGTCTCGAGACCCATTTCTTGAAGTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181079.1-567s1c1
Sequence:CCGGCCCTGCCTTCTACATGCTGAACTCGAGTTCAGCATGTAGAAGGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181079
IL21R MISSION shRNA Lentiviral Transduction Particles
interleukin 21 receptor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181079.1-201s21c1
Sequence:CCGGCCTCGTCTGCTACACCGATTACTCGAGTAATCGGTGTAGCAGACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181079.1-2244s21c1
Sequence:CCGGAGCTGCAAGAAGTCCATATTGCTCGAGCAATATGGACTTCTTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181079.1-807s21c1
Sequence:CCGGGACCCAGTCAGAGGAGTTAAACTCGAGTTTAACTCCTCTGACTGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181079.1-395s21c1
Sequence:CCGGACTTCATGGCCGACGACATTTCTCGAGAAATGTCGTCGGCCATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181079.1-1597s1c1
Sequence:CCGGGACACGTTTGACAGTGGCTTTCTCGAGAAAGCCACTGTCAAACGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181079.1-381s1c1
Sequence:CCGGCATGGATGTATTCCACTTCATCTCGAGATGAAGTGGAATACATCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181079.1-858s1c1
Sequence:CCGGCCTCCTGCTTGTCATAGTCTTCTCGAGAAGACTATGACAAGCAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181079.1-990s1c1
Sequence:CCGGCGGAGACTTCAAGAAATGGGTCTCGAGACCCATTTCTTGAAGTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181079.1-567s1c1
Sequence:CCGGCCCTGCCTTCTACATGCTGAACTCGAGTTCAGCATGTAGAAGGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021887
IL21R MISSION shRNA Bacterial Glycerol Stock
interleukin 21 receptor
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000067973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021887.1-1327s1c1
Sequence:CCGGGCCTTACATCTGTCATTGTATCTCGAGATACAATGACAGATGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021887.1-776s1c1
Sequence:CCGGCCTTCTCAGGACGCTATGATACTCGAGTATCATAGCGTCCTGAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021887.1-456s1c1
Sequence:CCGGCCTCACTTGCTACACTGACTACTCGAGTAGTCAGTGTAGCAAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021887.1-1392s1c1
Sequence:CCGGGCAACTGGAGTGTGATGGAATCTCGAGATTCCATCACACTCCAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021887
IL21R MISSION shRNA shRNA Plasmid DNA
interleukin 21 receptor
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000067973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021887.1-1327s1c1
Sequence:CCGGGCCTTACATCTGTCATTGTATCTCGAGATACAATGACAGATGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021887.1-776s1c1
Sequence:CCGGCCTTCTCAGGACGCTATGATACTCGAGTATCATAGCGTCCTGAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021887.1-456s1c1
Sequence:CCGGCCTCACTTGCTACACTGACTACTCGAGTAGTCAGTGTAGCAAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021887.1-1392s1c1
Sequence:CCGGGCAACTGGAGTGTGATGGAATCTCGAGATTCCATCACACTCCAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021887
IL21R MISSION shRNA Lentiviral Transduction Particles
interleukin 21 receptor
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000067973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021887.1-1327s1c1
Sequence:CCGGGCCTTACATCTGTCATTGTATCTCGAGATACAATGACAGATGTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021887.1-776s1c1
Sequence:CCGGCCTTCTCAGGACGCTATGATACTCGAGTATCATAGCGTCCTGAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021887.1-456s1c1
Sequence:CCGGCCTCACTTGCTACACTGACTACTCGAGTAGTCAGTGTAGCAAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021887.1-1392s1c1
Sequence:CCGGGCAACTGGAGTGTGATGGAATCTCGAGATTCCATCACACTCCAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)