EMAIL THIS PAGE TO A FRIEND

IL22

interleukin 22

104 Gene Product Result for
Synonyms: IL-21 IL-22 IL-D110 IL-TIF ILTIF TIFIL-23 TIFa zcyto18
UniProtKB ID: Q9GZX6
Gene ID:
Mouse(50929) interleukin 22
Rat(500836) interleukin 22
Zebrafish(553964) interleukin 22
dog(481153) interleukin 22
cow(507778) interleukin 22
domestic cat(101095184) interleukin 22
chicken(417838) interleukin 22
naked mole-rat(101700360) interleukin 22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3501070 Anti-IL-22 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
AV49523 Anti-IL22 antibody produced in rabbit affinity isolated antibody guinea pig, canine, rat, human, sheep, bovine, goat, horse, mouse, rabbit
western blot pricing
SAB1410873 Anti-IL22 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2702413 Anti-IL22 antibody produced in rabbit affinity isolated antibody mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016971 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016971 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016971 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020525 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020525 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020525 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020525 Rosetta Predictions human pricing
XM_001081002 Rosetta Predictions rat pricing
XM_576228 Rosetta Predictions rat pricing
NM_016971 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353570 predicted 236
2 SASI_Hs01_00030030 predicted 366
3 SASI_Hs01_00030031 predicted 236
4 SASI_Hs01_00030032 predicted 436
5 SASI_Hs01_00030033 predicted 211
6 SASI_Hs01_00030034 predicted 196
7 SASI_Hs01_00030035 predicted 437
8 SASI_Hs01_00030036 predicted 384
9 SASI_Hs01_00030037 predicted 428
10 SASI_Hs01_00030038 predicted 371
11 SASI_Hs01_00030029 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081002 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370194 predicted 238
2 SASI_Rn02_00370195 predicted 373
3 SASI_Rn02_00370196 predicted 394
4 SASI_Rn02_00370197 predicted 229
5 SASI_Rn02_00370198 predicted 388
6 SASI_Rn02_00370199 predicted 238
7 SASI_Rn02_00370200 predicted 425
8 SASI_Rn02_00370201 predicted 264
9 SASI_Rn02_00370202 predicted 420
10 SASI_Rn02_00370203 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576228 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404897 predicted 221
2 SASI_Rn02_00404898 predicted 360
3 SASI_Rn02_00404899 predicted 372
4 SASI_Rn02_00404900 predicted 207
5 SASI_Rn02_00404901 predicted 371
6 SASI_Rn02_00404902 predicted 216
7 SASI_Rn02_00404903 predicted 411
8 SASI_Rn02_00404904 predicted 243
9 SASI_Rn02_00404905 predicted 396
10 SASI_Rn02_00404906 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016971 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154120 predicted 1018
2 SASI_Mm01_00154121 predicted 1008
3 SASI_Mm01_00154122 predicted 1026
4 SASI_Mm01_00154123 predicted 1012
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016971
IL22 MISSION shRNA Bacterial Glycerol Stock
interleukin 22
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016971.1-245s1c1
Sequence:CCGGCCTTGCAGATAACAACACAGACTCGAGTCTGTGTTGTTATCTGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016971.1-464s1c1
Sequence:CCGGCGACCAGAACATCCAGAAGAACTCGAGTTCTTCTGGATGTTCTGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016971.1-525s1c1
Sequence:CCGGAGTGGAGAGATCAAGGCGATTCTCGAGAATCGCCTTGATCTCTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016971.1-560s1c1
Sequence:CCGGGCTGTTTATGTCTCTGAGAAACTCGAGTTTCTCAGAGACATAAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016971.1-294s1c1
Sequence:CCGGCGAGGAGTCAGTGCTAAAGATCTCGAGATCTTTAGCACTGACTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016971
IL22 MISSION shRNA shRNA Plasmid DNA
interleukin 22
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016971.1-245s1c1
Sequence:CCGGCCTTGCAGATAACAACACAGACTCGAGTCTGTGTTGTTATCTGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016971.1-464s1c1
Sequence:CCGGCGACCAGAACATCCAGAAGAACTCGAGTTCTTCTGGATGTTCTGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016971.1-525s1c1
Sequence:CCGGAGTGGAGAGATCAAGGCGATTCTCGAGAATCGCCTTGATCTCTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016971.1-560s1c1
Sequence:CCGGGCTGTTTATGTCTCTGAGAAACTCGAGTTTCTCAGAGACATAAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016971.1-294s1c1
Sequence:CCGGCGAGGAGTCAGTGCTAAAGATCTCGAGATCTTTAGCACTGACTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016971
IL22 MISSION shRNA Lentiviral Transduction Particles
interleukin 22
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016971.1-245s1c1
Sequence:CCGGCCTTGCAGATAACAACACAGACTCGAGTCTGTGTTGTTATCTGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016971.1-464s1c1
Sequence:CCGGCGACCAGAACATCCAGAAGAACTCGAGTTCTTCTGGATGTTCTGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016971.1-525s1c1
Sequence:CCGGAGTGGAGAGATCAAGGCGATTCTCGAGAATCGCCTTGATCTCTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016971.1-560s1c1
Sequence:CCGGGCTGTTTATGTCTCTGAGAAACTCGAGTTTCTCAGAGACATAAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016971.1-294s1c1
Sequence:CCGGCGAGGAGTCAGTGCTAAAGATCTCGAGATCTTTAGCACTGACTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020525
IL22 MISSION shRNA Bacterial Glycerol Stock
interleukin 22
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020525.4-524s1c1
Sequence:CCGGGAGTGGAGAGATCAAAGCAATCTCGAGATTGCTTTGATCTCTCCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020525.4-365s1c1
Sequence:CCGGGTTCCCTCAATCTGATAGGTTCTCGAGAACCTATCAGATTGAGGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020525.4-203s1c1
Sequence:CCGGCTATATCACCAACCGCACCTTCTCGAGAAGGTGCGGTTGGTGATATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020525.4-570s1c1
Sequence:CCGGTCTCTGAGAAATGCCTGCATTCTCGAGAATGCAGGCATTTCTCAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020525.4-338s1c1
Sequence:CCGGGCTGAACTTCACCCTTGAAGACTCGAGTCTTCAAGGGTGAAGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020525.4-435s21c1
Sequence:CCGGAGGCTAAGCACATGTCATATTCTCGAGAATATGACATGTGCTTAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020525.4-941s21c1
Sequence:CCGGGTTTCCATAATCAGTACTTTACTCGAGTAAAGTACTGATTATGGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020525.4-789s21c1
Sequence:CCGGAGACTTTCTAAGCATAGATATCTCGAGATATCTATGCTTAGAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020525
IL22 MISSION shRNA shRNA Plasmid DNA
interleukin 22
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020525.4-524s1c1
Sequence:CCGGGAGTGGAGAGATCAAAGCAATCTCGAGATTGCTTTGATCTCTCCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020525.4-365s1c1
Sequence:CCGGGTTCCCTCAATCTGATAGGTTCTCGAGAACCTATCAGATTGAGGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020525.4-203s1c1
Sequence:CCGGCTATATCACCAACCGCACCTTCTCGAGAAGGTGCGGTTGGTGATATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020525.4-570s1c1
Sequence:CCGGTCTCTGAGAAATGCCTGCATTCTCGAGAATGCAGGCATTTCTCAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020525.4-338s1c1
Sequence:CCGGGCTGAACTTCACCCTTGAAGACTCGAGTCTTCAAGGGTGAAGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020525.4-435s21c1
Sequence:CCGGAGGCTAAGCACATGTCATATTCTCGAGAATATGACATGTGCTTAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020525.4-941s21c1
Sequence:CCGGGTTTCCATAATCAGTACTTTACTCGAGTAAAGTACTGATTATGGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020525.4-789s21c1
Sequence:CCGGAGACTTTCTAAGCATAGATATCTCGAGATATCTATGCTTAGAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020525
IL22 MISSION shRNA Lentiviral Transduction Particles
interleukin 22
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020525.4-524s1c1
Sequence:CCGGGAGTGGAGAGATCAAAGCAATCTCGAGATTGCTTTGATCTCTCCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020525.4-365s1c1
Sequence:CCGGGTTCCCTCAATCTGATAGGTTCTCGAGAACCTATCAGATTGAGGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020525.4-203s1c1
Sequence:CCGGCTATATCACCAACCGCACCTTCTCGAGAAGGTGCGGTTGGTGATATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020525.4-570s1c1
Sequence:CCGGTCTCTGAGAAATGCCTGCATTCTCGAGAATGCAGGCATTTCTCAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020525.4-338s1c1
Sequence:CCGGGCTGAACTTCACCCTTGAAGACTCGAGTCTTCAAGGGTGAAGTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020525.4-435s21c1
Sequence:CCGGAGGCTAAGCACATGTCATATTCTCGAGAATATGACATGTGCTTAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020525.4-941s21c1
Sequence:CCGGGTTTCCATAATCAGTACTTTACTCGAGTAAAGTACTGATTATGGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020525.4-789s21c1
Sequence:CCGGAGACTTTCTAAGCATAGATATCTCGAGATATCTATGCTTAGAAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)