EMAIL THIS PAGE TO A FRIEND

IL23A

interleukin 23, alpha subunit p19

89 Gene Product Result for
Synonyms: IL-23 IL-23A IL23P19 P19 SGRF
UniProtKB ID: Q9NPF7, Q6NZ80, Q6NZ82, Q9H2A5
Gene ID:
Human(51561) Summary: This gene encodes a subunit of the heterodimeric cytokine interleukin 23 (IL23). IL23 is composed of this protein and the p40 subunit of interleukin 12 (IL12B). The receptor of IL23 is formed by the beta 1 subunit of IL12 (IL12RB1) and an IL23 specific subunit, IL23R. Both IL23 and IL12 can activate the transcription activator STAT4, and stimulate the production of interferon-gamma (IFNG). In contrast to IL12, which acts mainly on naive CD4(+) T cells, IL23 preferentially acts on memory CD4(+) T cells. [provided by RefSeq, Jul 2008]
Mouse(83430) interleukin 23, alpha subunit p19
Rat(155140) Interleukin 23, alpha subunit p19
domestic guinea pig(100135557) interleukin 23, alpha subunit p19
naked mole-rat(101707902) interleukin 23, alpha subunit p19
sheep(100462692) interleukin 23, alpha subunit p19
chicken(100858964) interleukin 23, alpha subunit p19
dog(481110) interleukin 23, alpha subunit p19
Horse(100034230) interleukin 23, alpha subunit p19
cow(511022) interleukin 23, alpha subunit p19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016584 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016584 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016584 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031252 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031252 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031252 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016584 Rosetta Predictions human pricing
NM_130410 Rosetta Predictions rat pricing
NM_031252 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120202 predicted 710
2 SASI_Hs01_00120203 predicted 807
3 SASI_Hs02_00349714 predicted 341
4 SASI_Hs01_00120205 predicted 296
5 SASI_Hs01_00120206 predicted 313
6 SASI_Hs01_00120207 predicted 438
7 SASI_Hs02_00349715 predicted 769
8 SASI_Hs01_00120208 predicted 585
9 SASI_Hs01_00120209 predicted 709
10 SASI_Hs01_00120210 predicted 575
11 SASI_Hs01_00120204 predicted 419
12 SASI_Hs01_00120211 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130410 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105893 predicted 1123
2 SASI_Rn01_00105894 predicted 303
3 SASI_Rn01_00105895 predicted 443
4 SASI_Rn01_00105896 predicted 1015
5 SASI_Rn01_00105898 predicted 944
6 SASI_Rn02_00267403 predicted 658
7 SASI_Rn01_00105899 predicted 716
8 SASI_Rn01_00105900 predicted 514
9 SASI_Rn01_00105901 predicted 826
10 SASI_Rn02_00267404 predicted 860
11 SASI_Rn01_00105897 predicted 1212
12 SASI_Rn01_00105902 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031252 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076119 predicted 745
2 SASI_Mm02_00337077 predicted 674
3 SASI_Mm02_00337078 predicted 420
4 SASI_Mm02_00337079 predicted 492
5 SASI_Mm01_00076122 predicted 720
6 SASI_Mm01_00076123 predicted 352
7 SASI_Mm01_00076124 predicted 736
8 SASI_Mm01_00076126 predicted 670
9 SASI_Mm01_00076127 predicted 760
10 SASI_Mm01_00076128 predicted 1023
11 SASI_Mm01_00076120 predicted 780
12 SASI_Mm01_00076121 predicted 931
13 SASI_Mm01_00076125 predicted 782
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016584
IL23A MISSION shRNA Bacterial Glycerol Stock
interleukin 23, alpha subunit p19
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016584.2-811s21c1
Sequence:CCGGCTGTGAGCCAACAGGTTAATTCTCGAGAATTAACCTGTTGGCTCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016584.2-717s21c1
Sequence:CCGGCAGCAACCCTGAGTCCCTAAACTCGAGTTTAGGGACTCAGGGTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016584.2-441s21c1
Sequence:CCGGGGATCCACCAGGGTCTGATTTCTCGAGAAATCAGACCCTGGTGGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016584.2-342s1c1
Sequence:CCGGAGGGAGATGAAGAGACTACAACTCGAGTTGTAGTCTCTTCATCTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016584.2-329s1c1
Sequence:CCGGGATCTAAGAGAAGAGGGAGATCTCGAGATCTCCCTCTTCTCTTAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016584.2-409s1c1
Sequence:CCGGACTCAGGGACAACAGTCAGTTCTCGAGAACTGACTGTTGTCCCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016584.2-671s1c1
Sequence:CCGGCTCCAGGCCTTTGTGGCTGTACTCGAGTACAGCCACAAAGGCCTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016584.2-471s1c1
Sequence:CCGGAGCTGCTAGGATCGGATATTTCTCGAGAAATATCCGATCCTAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016584
IL23A MISSION shRNA shRNA Plasmid DNA
interleukin 23, alpha subunit p19
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016584.2-811s21c1
Sequence:CCGGCTGTGAGCCAACAGGTTAATTCTCGAGAATTAACCTGTTGGCTCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016584.2-717s21c1
Sequence:CCGGCAGCAACCCTGAGTCCCTAAACTCGAGTTTAGGGACTCAGGGTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016584.2-441s21c1
Sequence:CCGGGGATCCACCAGGGTCTGATTTCTCGAGAAATCAGACCCTGGTGGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016584.2-342s1c1
Sequence:CCGGAGGGAGATGAAGAGACTACAACTCGAGTTGTAGTCTCTTCATCTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016584.2-329s1c1
Sequence:CCGGGATCTAAGAGAAGAGGGAGATCTCGAGATCTCCCTCTTCTCTTAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016584.2-409s1c1
Sequence:CCGGACTCAGGGACAACAGTCAGTTCTCGAGAACTGACTGTTGTCCCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016584.2-671s1c1
Sequence:CCGGCTCCAGGCCTTTGTGGCTGTACTCGAGTACAGCCACAAAGGCCTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016584.2-471s1c1
Sequence:CCGGAGCTGCTAGGATCGGATATTTCTCGAGAAATATCCGATCCTAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016584
IL23A MISSION shRNA Lentiviral Transduction Particles
interleukin 23, alpha subunit p19
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016584.2-811s21c1
Sequence:CCGGCTGTGAGCCAACAGGTTAATTCTCGAGAATTAACCTGTTGGCTCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016584.2-717s21c1
Sequence:CCGGCAGCAACCCTGAGTCCCTAAACTCGAGTTTAGGGACTCAGGGTTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016584.2-441s21c1
Sequence:CCGGGGATCCACCAGGGTCTGATTTCTCGAGAAATCAGACCCTGGTGGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016584.2-342s1c1
Sequence:CCGGAGGGAGATGAAGAGACTACAACTCGAGTTGTAGTCTCTTCATCTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016584.2-329s1c1
Sequence:CCGGGATCTAAGAGAAGAGGGAGATCTCGAGATCTCCCTCTTCTCTTAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016584.2-409s1c1
Sequence:CCGGACTCAGGGACAACAGTCAGTTCTCGAGAACTGACTGTTGTCCCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016584.2-671s1c1
Sequence:CCGGCTCCAGGCCTTTGTGGCTGTACTCGAGTACAGCCACAAAGGCCTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016584.2-471s1c1
Sequence:CCGGAGCTGCTAGGATCGGATATTTCTCGAGAAATATCCGATCCTAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031252
VALIDATED
IL23A MISSION shRNA Bacterial Glycerol Stock
interleukin 23, alpha subunit p19
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031252.2-370s21c1
Sequence:CCGGCAGCCAGTTCTGCTTGCAAAGCTCGAGCTTTGCAAGCAGAACTGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031252.2-484s21c1
Sequence:CCGGACTTCACACCTCCCTACTAGGCTCGAGCCTAGTAGGGAGGTGTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031252.2-321s21c1
Sequence:CCGGCCCGTATCCAGTGTGAAGATGCTCGAGCATCTTCACACTGGATACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031252.2-181s21c1
Sequence:CCGGTAGGAGTAGCAGTCCTGACTGCTCGAGCAGTCAGGACTGCTACTCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031252.2-818s21c1
Sequence:CCGGAGGGCAAGGACACCATTATTACTCGAGTAATAATGGTGTCCTTGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031252.1-264s1c1
Sequence:CCGGCGGGACATATGAATCTACTAACTCGAGTTAGTAGATTCATATGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031252.1-682s1c1
Sequence:CCGGGCCCTTAGTGCCAACAGCTTACTCGAGTAAGCTGTTGGCACTAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031252.1-424s1c1
Sequence:CCGGGCTTGACTCTGACATCTTCAACTCGAGTTGAAGATGTCAGAGTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031252.1-221s1c1
Sequence:CCGGTCTCGGAATCTCTGCATGCTACTCGAGTAGCATGCAGAGATTCCGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031252.1-593s1c1
Sequence:CCGGCTTCTCCGTTCCAAGATCCTTCTCGAGAAGGATCTTGGAACGGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031252
VALIDATED
IL23A MISSION shRNA shRNA Plasmid DNA
interleukin 23, alpha subunit p19
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031252.2-370s21c1
Sequence:CCGGCAGCCAGTTCTGCTTGCAAAGCTCGAGCTTTGCAAGCAGAACTGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031252.2-484s21c1
Sequence:CCGGACTTCACACCTCCCTACTAGGCTCGAGCCTAGTAGGGAGGTGTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031252.2-321s21c1
Sequence:CCGGCCCGTATCCAGTGTGAAGATGCTCGAGCATCTTCACACTGGATACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031252.2-181s21c1
Sequence:CCGGTAGGAGTAGCAGTCCTGACTGCTCGAGCAGTCAGGACTGCTACTCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031252.2-818s21c1
Sequence:CCGGAGGGCAAGGACACCATTATTACTCGAGTAATAATGGTGTCCTTGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031252.1-264s1c1
Sequence:CCGGCGGGACATATGAATCTACTAACTCGAGTTAGTAGATTCATATGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031252.1-682s1c1
Sequence:CCGGGCCCTTAGTGCCAACAGCTTACTCGAGTAAGCTGTTGGCACTAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031252.1-424s1c1
Sequence:CCGGGCTTGACTCTGACATCTTCAACTCGAGTTGAAGATGTCAGAGTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031252.1-221s1c1
Sequence:CCGGTCTCGGAATCTCTGCATGCTACTCGAGTAGCATGCAGAGATTCCGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031252.1-593s1c1
Sequence:CCGGCTTCTCCGTTCCAAGATCCTTCTCGAGAAGGATCTTGGAACGGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031252
VALIDATED
IL23A MISSION shRNA Lentiviral Transduction Particles
interleukin 23, alpha subunit p19
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031252.2-370s21c1
Sequence:CCGGCAGCCAGTTCTGCTTGCAAAGCTCGAGCTTTGCAAGCAGAACTGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031252.2-484s21c1
Sequence:CCGGACTTCACACCTCCCTACTAGGCTCGAGCCTAGTAGGGAGGTGTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031252.2-321s21c1
Sequence:CCGGCCCGTATCCAGTGTGAAGATGCTCGAGCATCTTCACACTGGATACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031252.2-181s21c1
Sequence:CCGGTAGGAGTAGCAGTCCTGACTGCTCGAGCAGTCAGGACTGCTACTCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031252.2-818s21c1
Sequence:CCGGAGGGCAAGGACACCATTATTACTCGAGTAATAATGGTGTCCTTGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031252.1-264s1c1
Sequence:CCGGCGGGACATATGAATCTACTAACTCGAGTTAGTAGATTCATATGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031252.1-682s1c1
Sequence:CCGGGCCCTTAGTGCCAACAGCTTACTCGAGTAAGCTGTTGGCACTAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031252.1-424s1c1
Sequence:CCGGGCTTGACTCTGACATCTTCAACTCGAGTTGAAGATGTCAGAGTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031252.1-221s1c1
Sequence:CCGGTCTCGGAATCTCTGCATGCTACTCGAGTAGCATGCAGAGATTCCGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031252.1-593s1c1
Sequence:CCGGCTTCTCCGTTCCAAGATCCTTCTCGAGAAGGATCTTGGAACGGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)