EMAIL THIS PAGE TO A FRIEND

IL23R

interleukin 23 receptor

174 Gene Product Result for
Gene ID:
Human(149233) Summary: The protein encoded by this gene is a subunit of the receptor for IL23A/IL23. This protein pairs with the receptor molecule IL12RB1/IL12Rbeta1, and both are required for IL23A signaling. This protein associates constitutively with Janus kinase 2 (JAK2), and also binds to transcription activator STAT3 in a ligand-dependent manner. [provided by RefSeq, Jul 2008]
Mouse(209590) interleukin 23 receptor
Rat(689932) interleukin 23 receptor
Zebrafish(100134972) interleukin 23 receptor
cow(614367) interleukin 23 receptor
Horse(100053807) interleukin 23 receptor
domestic cat(101087763) interleukin 23 receptor
dog(609732) interleukin 23 receptor
chicken(424704) interleukin 23 receptor
sheep(101103528) interleukin 23 receptor
Domestic Rabbit(100350917) interleukin 23 receptor
domestic guinea pig(100723049) interleukin 23 receptor
naked mole-rat(101697943) interleukin 23 receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1524 Human IL-23 R ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144701 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144701 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144701 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144548 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144548 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144548 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069331 MISSION® esiRNA esiRNA human IL23R (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144701 Rosetta Predictions human pricing
XM_001072576 Rosetta Predictions rat pricing
NM_144548 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065502 predicted 948
2 SASI_Hs02_00364626 predicted 388
3 SASI_Hs02_00364627 predicted 1111
4 SASI_Hs01_00065504 predicted 1087
5 SASI_Hs01_00065505 predicted 254
6 SASI_Hs01_00065506 predicted 558
7 SASI_Hs01_00065507 predicted 1816
8 SASI_Hs01_00065508 predicted 938
9 SASI_Hs02_00364628 predicted 1514
10 SASI_Hs02_00364629 predicted 459
11 SASI_Hs01_00065500 predicted 477
12 SASI_Hs01_00065501 predicted 1697
13 SASI_Hs01_00065503 predicted 1339
14 SASI_Hs01_00065509 predicted 1737
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072576 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339719 predicted 563
2 SASI_Rn02_00339720 predicted 815
3 SASI_Rn02_00339721 predicted 796
4 SASI_Rn02_00339722 predicted 218
5 SASI_Rn02_00339723 predicted 649
6 SASI_Rn02_00339724 predicted 383
7 SASI_Rn02_00339725 predicted 532
8 SASI_Rn02_00339726 predicted 1129
9 SASI_Rn02_00339727 predicted 856
10 SASI_Rn02_00339728 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116577 predicted 345
2 SASI_Mm01_00116578 predicted 372
3 SASI_Mm01_00116579 predicted 683
4 SASI_Mm01_00116580 predicted 2149
5 SASI_Mm01_00116581 predicted 921
6 SASI_Mm02_00340087 predicted 1800
7 SASI_Mm01_00116582 predicted 771
8 SASI_Mm01_00116583 predicted 707
9 SASI_Mm01_00116584 predicted 1904
10 SASI_Mm01_00116585 predicted 650
11 SASI_Mm01_00116586 predicted 1969
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144701
IL23R MISSION shRNA Bacterial Glycerol Stock
interleukin 23 receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144701.2-1492s1c1
Sequence:CCGGCGACAATACTACAGTTGTATACTCGAGTATACAACTGTAGTATTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144701.2-113s1c1
Sequence:CCGGGCAGTAATAGCCCTTTACATACTCGAGTATGTAAAGGGCTATTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144701.2-1823s1c1
Sequence:CCGGCCCAGTGAAACTATTCCAGAACTCGAGTTCTGGAATAGTTTCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144701.2-1517s1c1
Sequence:CCGGCCTGATCTCAACACTGGATATCTCGAGATATCCAGTGTTGAGATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144701.2-245s1c1
Sequence:CCGGGCAGCAATTAAGAACTGCCAACTCGAGTTGGCAGTTCTTAATTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144701.2-1193s21c1
Sequence:CCGGCTTTCTTTGATTGGGATATTTCTCGAGAAATATCCCAATCAAAGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144701.2-1155s21c1
Sequence:CCGGTATTGGGAATGATCGTCTTTGCTCGAGCAAAGACGATCATTCCCAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144701.2-602s21c1
Sequence:CCGGTATCTCACCTCAAGCTATATTCTCGAGAATATAGCTTGAGGTGAGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144701
IL23R MISSION shRNA shRNA Plasmid DNA
interleukin 23 receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144701.2-1492s1c1
Sequence:CCGGCGACAATACTACAGTTGTATACTCGAGTATACAACTGTAGTATTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144701.2-113s1c1
Sequence:CCGGGCAGTAATAGCCCTTTACATACTCGAGTATGTAAAGGGCTATTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144701.2-1823s1c1
Sequence:CCGGCCCAGTGAAACTATTCCAGAACTCGAGTTCTGGAATAGTTTCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144701.2-1517s1c1
Sequence:CCGGCCTGATCTCAACACTGGATATCTCGAGATATCCAGTGTTGAGATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144701.2-245s1c1
Sequence:CCGGGCAGCAATTAAGAACTGCCAACTCGAGTTGGCAGTTCTTAATTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144701.2-1193s21c1
Sequence:CCGGCTTTCTTTGATTGGGATATTTCTCGAGAAATATCCCAATCAAAGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144701.2-1155s21c1
Sequence:CCGGTATTGGGAATGATCGTCTTTGCTCGAGCAAAGACGATCATTCCCAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144701.2-602s21c1
Sequence:CCGGTATCTCACCTCAAGCTATATTCTCGAGAATATAGCTTGAGGTGAGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144701
IL23R MISSION shRNA Lentiviral Transduction Particles
interleukin 23 receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144701.2-1492s1c1
Sequence:CCGGCGACAATACTACAGTTGTATACTCGAGTATACAACTGTAGTATTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144701.2-113s1c1
Sequence:CCGGGCAGTAATAGCCCTTTACATACTCGAGTATGTAAAGGGCTATTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144701.2-1823s1c1
Sequence:CCGGCCCAGTGAAACTATTCCAGAACTCGAGTTCTGGAATAGTTTCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144701.2-1517s1c1
Sequence:CCGGCCTGATCTCAACACTGGATATCTCGAGATATCCAGTGTTGAGATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144701.2-245s1c1
Sequence:CCGGGCAGCAATTAAGAACTGCCAACTCGAGTTGGCAGTTCTTAATTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144701.2-1193s21c1
Sequence:CCGGCTTTCTTTGATTGGGATATTTCTCGAGAAATATCCCAATCAAAGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144701.2-1155s21c1
Sequence:CCGGTATTGGGAATGATCGTCTTTGCTCGAGCAAAGACGATCATTCCCAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144701.2-602s21c1
Sequence:CCGGTATCTCACCTCAAGCTATATTCTCGAGAATATAGCTTGAGGTGAGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144548
IL23R MISSION shRNA Bacterial Glycerol Stock
interleukin 23 receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144548.1-1517s1c1
Sequence:CCGGCCACAGATTACAAAGAAGAAACTCGAGTTTCTTCTTTGTAATCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144548.1-575s1c1
Sequence:CCGGCCTACATAGATACCAAGTATACTCGAGTATACTTGGTATCTATGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144548.1-2197s1c1
Sequence:CCGGGCTGTGCTTGTTTGCTTGTTTCTCGAGAAACAAGCAAACAAGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144548.1-186s1c1
Sequence:CCGGCGGAGGAATCACAAGTATAAACTCGAGTTTATACTTGTGATTCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144548.1-1516s1c1
Sequence:CCGGCCCACAGATTACAAAGAAGAACTCGAGTTCTTCTTTGTAATCTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144548
IL23R MISSION shRNA shRNA Plasmid DNA
interleukin 23 receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144548.1-1517s1c1
Sequence:CCGGCCACAGATTACAAAGAAGAAACTCGAGTTTCTTCTTTGTAATCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144548.1-575s1c1
Sequence:CCGGCCTACATAGATACCAAGTATACTCGAGTATACTTGGTATCTATGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144548.1-2197s1c1
Sequence:CCGGGCTGTGCTTGTTTGCTTGTTTCTCGAGAAACAAGCAAACAAGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144548.1-186s1c1
Sequence:CCGGCGGAGGAATCACAAGTATAAACTCGAGTTTATACTTGTGATTCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144548.1-1516s1c1
Sequence:CCGGCCCACAGATTACAAAGAAGAACTCGAGTTCTTCTTTGTAATCTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144548
IL23R MISSION shRNA Lentiviral Transduction Particles
interleukin 23 receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144548.1-1517s1c1
Sequence:CCGGCCACAGATTACAAAGAAGAAACTCGAGTTTCTTCTTTGTAATCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144548.1-575s1c1
Sequence:CCGGCCTACATAGATACCAAGTATACTCGAGTATACTTGGTATCTATGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144548.1-2197s1c1
Sequence:CCGGGCTGTGCTTGTTTGCTTGTTTCTCGAGAAACAAGCAAACAAGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144548.1-186s1c1
Sequence:CCGGCGGAGGAATCACAAGTATAAACTCGAGTTTATACTTGTGATTCCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144548.1-1516s1c1
Sequence:CCGGCCCACAGATTACAAAGAAGAACTCGAGTTCTTCTTTGTAATCTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)