EMAIL THIS PAGE TO A FRIEND

IL24

interleukin 24

140 Gene Product Result for
Synonyms: C49A FISP IL10B MDA7 MOB5 ST16
UniProtKB ID: Q13007, Q2YHE5, Q53XZ7, Q5YLN8, Q96DB0, Q96KG4
Gene ID:
Human(11009) Summary: This gene encodes a member of the IL10 family of cytokines. It was identified as a gene induced during terminal differentiation in melanoma cells. The protein encoded by this gene can induce apoptosis selectively in various cancer cells. Overexpression of this gene leads to elevated expression of several GADD family genes, which correlates with the induction of apoptosis. The phosphorylation of mitogen-activated protein kinase 14 (MAPK7/P38), and heat shock 27kDa protein 1 (HSPB2/HSP27) are found to be induced by this gene in melanoma cells, but not in normal immortal melanocytes. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(93672) interleukin 24
Rat(170819) interleukin 24
naked mole-rat(101707178) interleukin 24
sheep(101113424) interleukin 24
dog(609213) interleukin 24
cow(526285) interleukin 24
domestic cat(101095874) interleukin 24
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0698 Human IL24 / Interleukin-24 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006850 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006850 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006850 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053095 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053095 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053095 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU077581 MISSION® esiRNA esiRNA human IL24 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006850 Rosetta Predictions human pricing
NM_181339 Rosetta Predictions human pricing
NM_133311 Rosetta Predictions rat pricing
NM_053095 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097938 predicted 933
2 SASI_Hs01_00097940 predicted 948
3 SASI_Hs01_00097941 predicted 721
4 SASI_Hs01_00097942 predicted 874
5 SASI_Hs01_00097943 predicted 807
6 SASI_Hs01_00097944 predicted 799
7 SASI_Hs01_00097945 predicted 763
8 SASI_Hs02_00342449 predicted 776
9 SASI_Hs01_00097946 predicted 784
10 SASI_Hs02_00342450 predicted 788
11 SASI_Hs01_00097939 predicted 856
12 SASI_Hs01_00097947 predicted 930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186325 predicted 592
2 SASI_Hs02_00369997 predicted 583
3 SASI_Hs01_00186327 predicted 610
4 SASI_Hs01_00186328 predicted 531
5 SASI_Hs01_00186329 predicted 467
6 SASI_Hs01_00186330 predicted 452
7 SASI_Hs01_00186331 predicted 421
8 SASI_Hs01_00186332 predicted 435
9 SASI_Hs01_00186333 predicted 438
10 SASI_Hs01_00186334 predicted 587
11 SASI_Hs01_00186326 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133311 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113661 predicted 317
2 SASI_Rn01_00113662 predicted 429
3 SASI_Rn01_00113663 predicted 912
4 SASI_Rn02_00267615 predicted 384
5 SASI_Rn01_00113664 predicted 914
6 SASI_Rn01_00113665 predicted 904
7 SASI_Rn01_00113666 predicted 622
8 SASI_Rn01_00113667 predicted 497
9 SASI_Rn02_00267616 predicted 681
10 SASI_Rn01_00113668 predicted 260
11 SASI_Rn01_00113669 predicted 621
12 SASI_Rn01_00113670 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053095 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162487 predicted 565
2 SASI_Mm01_00162488 predicted 712
3 SASI_Mm01_00162489 predicted 475
4 SASI_Mm01_00162490 predicted 572
5 SASI_Mm01_00162491 predicted 639
6 SASI_Mm01_00162492 predicted 637
7 SASI_Mm02_00337590 predicted 270
8 SASI_Mm01_00162493 predicted 453
9 SASI_Mm01_00162494 predicted 830
10 SASI_Mm01_00162495 predicted 345
11 SASI_Mm01_00162496 predicted 880
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006850
IL24 MISSION shRNA Bacterial Glycerol Stock
interleukin 24
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006850.2-575s21c1
Sequence:CCGGTCGGATGCTGAGAGCTGTTACCTCGAGGTAACAGCTCTCAGCATCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006850.2-665s21c1
Sequence:CCGGGTCAGGACTCTGAAGTCATTCCTCGAGGAATGACTTCAGAGTCCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006850.2-773s21c1
Sequence:CCGGCACAGGCGGTTTCTGCTATTCCTCGAGGAATAGCAGAAACCGCCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006850.2-865s1c1
Sequence:CCGGGACCTGGATGCAGAAATTCTACTCGAGTAGAATTTCTGCATCCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006850.2-422s1c1
Sequence:CCGGCAGGGCCAAGAATTCCACTTTCTCGAGAAAGTGGAATTCTTGGCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006850.2-607s1c1
Sequence:CCGGCCTGCTGGAGTTCTACTTGAACTCGAGTTCAAGTAGAACTCCAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006850.2-800s1c1
Sequence:CCGGGCATTCAAACAGTTGGACGTACTCGAGTACGTCCAACTGTTTGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006850.2-497s1c1
Sequence:CCGGGCTGTGAAAGACACTATGCAACTCGAGTTGCATAGTGTCTTTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006850
IL24 MISSION shRNA shRNA Plasmid DNA
interleukin 24
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006850.2-575s21c1
Sequence:CCGGTCGGATGCTGAGAGCTGTTACCTCGAGGTAACAGCTCTCAGCATCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006850.2-665s21c1
Sequence:CCGGGTCAGGACTCTGAAGTCATTCCTCGAGGAATGACTTCAGAGTCCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006850.2-773s21c1
Sequence:CCGGCACAGGCGGTTTCTGCTATTCCTCGAGGAATAGCAGAAACCGCCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006850.2-865s1c1
Sequence:CCGGGACCTGGATGCAGAAATTCTACTCGAGTAGAATTTCTGCATCCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006850.2-422s1c1
Sequence:CCGGCAGGGCCAAGAATTCCACTTTCTCGAGAAAGTGGAATTCTTGGCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006850.2-607s1c1
Sequence:CCGGCCTGCTGGAGTTCTACTTGAACTCGAGTTCAAGTAGAACTCCAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006850.2-800s1c1
Sequence:CCGGGCATTCAAACAGTTGGACGTACTCGAGTACGTCCAACTGTTTGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006850.2-497s1c1
Sequence:CCGGGCTGTGAAAGACACTATGCAACTCGAGTTGCATAGTGTCTTTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006850
IL24 MISSION shRNA Lentiviral Transduction Particles
interleukin 24
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006850.2-575s21c1
Sequence:CCGGTCGGATGCTGAGAGCTGTTACCTCGAGGTAACAGCTCTCAGCATCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006850.2-665s21c1
Sequence:CCGGGTCAGGACTCTGAAGTCATTCCTCGAGGAATGACTTCAGAGTCCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006850.2-773s21c1
Sequence:CCGGCACAGGCGGTTTCTGCTATTCCTCGAGGAATAGCAGAAACCGCCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006850.2-865s1c1
Sequence:CCGGGACCTGGATGCAGAAATTCTACTCGAGTAGAATTTCTGCATCCAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006850.2-422s1c1
Sequence:CCGGCAGGGCCAAGAATTCCACTTTCTCGAGAAAGTGGAATTCTTGGCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006850.2-607s1c1
Sequence:CCGGCCTGCTGGAGTTCTACTTGAACTCGAGTTCAAGTAGAACTCCAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006850.2-800s1c1
Sequence:CCGGGCATTCAAACAGTTGGACGTACTCGAGTACGTCCAACTGTTTGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006850.2-497s1c1
Sequence:CCGGGCTGTGAAAGACACTATGCAACTCGAGTTGCATAGTGTCTTTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053095
IL24 MISSION shRNA Bacterial Glycerol Stock
interleukin 24
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053095.1-699s1c1
Sequence:CCGGCCGCAGAGCATTCAAACAGTTCTCGAGAACTGTTTGAATGCTCTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053095.1-623s1c1
Sequence:CCGGTGTCACAACTACAGCCCAGTACTCGAGTACTGGGCTGTAGTTGTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053095.1-510s1c1
Sequence:CCGGCAGCCTGCTGAAGTTCTACTTCTCGAGAAGTAGAACTTCAGCAGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053095.1-286s1c1
Sequence:CCGGCTGAGCCTAATCCTTCTTCTTCTCGAGAAGAAGAAGGATTAGGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053095.1-730s1c1
Sequence:CCGGGTCGCTTTGGTGAAAGCCTTTCTCGAGAAAGGCTTTCACCAAAGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053095
IL24 MISSION shRNA shRNA Plasmid DNA
interleukin 24
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053095.1-699s1c1
Sequence:CCGGCCGCAGAGCATTCAAACAGTTCTCGAGAACTGTTTGAATGCTCTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053095.1-623s1c1
Sequence:CCGGTGTCACAACTACAGCCCAGTACTCGAGTACTGGGCTGTAGTTGTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053095.1-510s1c1
Sequence:CCGGCAGCCTGCTGAAGTTCTACTTCTCGAGAAGTAGAACTTCAGCAGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053095.1-286s1c1
Sequence:CCGGCTGAGCCTAATCCTTCTTCTTCTCGAGAAGAAGAAGGATTAGGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053095.1-730s1c1
Sequence:CCGGGTCGCTTTGGTGAAAGCCTTTCTCGAGAAAGGCTTTCACCAAAGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053095
IL24 MISSION shRNA Lentiviral Transduction Particles
interleukin 24
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053095.1-699s1c1
Sequence:CCGGCCGCAGAGCATTCAAACAGTTCTCGAGAACTGTTTGAATGCTCTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053095.1-623s1c1
Sequence:CCGGTGTCACAACTACAGCCCAGTACTCGAGTACTGGGCTGTAGTTGTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053095.1-510s1c1
Sequence:CCGGCAGCCTGCTGAAGTTCTACTTCTCGAGAAGTAGAACTTCAGCAGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053095.1-286s1c1
Sequence:CCGGCTGAGCCTAATCCTTCTTCTTCTCGAGAAGAAGAAGGATTAGGCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053095.1-730s1c1
Sequence:CCGGGTCGCTTTGGTGAAAGCCTTTCTCGAGAAAGGCTTTCACCAAAGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)