EMAIL THIS PAGE TO A FRIEND

IL25

interleukin 25

94 Gene Product Result for
Synonyms: IL17E
UniProtKB ID: Q9H293, Q2M3F0, Q8IZV3, Q8WXB0
Gene ID:
Human(64806) Summary: The protein encoded by this gene is a cytokine that shares sequence similarity with interleukin 17. This cytokine can induce NF-kappaB activation, and stimulate the production of interleukin 8. Both this cytokine and interleukin 17B are ligands for the cytokine receptor IL17BR. Studies of a similar gene in mice suggest that this cytokine may be a pro-inflammatory cytokine favoring the Th2-type immune response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Mouse(140806) interleukin 25
Rat(501996) interleukin 25
cow(526816) interleukin 25
domestic cat(101095746) interleukin 25
dog(480252) interleukin 25
sheep(100499506) interleukin 25
naked mole-rat(101708281) interleukin 25
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080729 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080729 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080729 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022789 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022789 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022789 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022789 Rosetta Predictions human pricing
NM_172314 Rosetta Predictions human pricing
XM_001054877 Rosetta Predictions rat pricing
XM_577423 Rosetta Predictions rat pricing
NM_080729 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218942 predicted 792
2 SASI_Hs01_00218943 predicted 749
3 SASI_Hs01_00218944 predicted 1026
4 SASI_Hs01_00218946 predicted 757
5 SASI_Hs01_00218947 predicted 572
6 SASI_Hs01_00218948 predicted 891
7 SASI_Hs01_00218949 predicted 785
8 SASI_Hs02_00356098 predicted 1098
9 SASI_Hs01_00218950 predicted 769
10 SASI_Hs01_00218951 predicted 887
11 SASI_Hs01_00218945 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168132 predicted 591
2 SASI_Hs01_00168133 predicted 542
3 SASI_Hs01_00168134 predicted 828
4 SASI_Hs01_00168136 predicted 559
5 SASI_Hs01_00168137 predicted 374
6 SASI_Hs01_00168138 predicted 693
7 SASI_Hs01_00168139 predicted 590
8 SASI_Hs02_00367972 predicted 890
9 SASI_Hs01_00168140 predicted 570
10 SASI_Hs01_00168141 predicted 688
11 SASI_Hs01_00168135 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054877 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277582 predicted 238
2 SASI_Rn02_00277583 predicted 227
3 SASI_Rn02_00277584 predicted 204
4 SASI_Rn02_00277585 predicted 244
5 SASI_Rn02_00277586 predicted 276
6 SASI_Rn02_00277587 predicted 227
7 SASI_Rn02_00277588 predicted 245
8 SASI_Rn02_00277589 predicted 230
9 SASI_Rn02_00277590 predicted 247
10 SASI_Rn02_00277591 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577423 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00155509 predicted 245
2 SASI_Rn01_00155510 predicted 224
3 SASI_Rn01_00155511 predicted 198
4 SASI_Rn01_00155512 predicted 247
5 SASI_Rn01_00155514 predicted 279
6 SASI_Rn02_00406592 predicted 227
7 SASI_Rn01_00155515 predicted 245
8 SASI_Rn01_00155516 predicted 233
9 SASI_Rn01_00155517 predicted 244
10 SASI_Rn01_00155518 predicted 228
11 SASI_Rn01_00155513 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080729 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103204 predicted 240
2 SASI_Mm01_00103205 predicted 230
3 SASI_Mm01_00103206 predicted 350
4 SASI_Mm02_00338207 predicted 721
5 SASI_Mm01_00103208 predicted 626
6 SASI_Mm01_00103209 predicted 246
7 SASI_Mm01_00103211 predicted 728
8 SASI_Mm01_00103212 predicted 687
9 SASI_Mm01_00103213 predicted 727
10 SASI_Mm02_00338208 predicted 429
11 SASI_Mm01_00103207 predicted 459
12 SASI_Mm01_00103210 predicted 228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080729
IL25 MISSION shRNA Bacterial Glycerol Stock
interleukin 25
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080729.1-458s1c1
Sequence:CCGGTCTACCGAGTCTCCTTGGCTTCTCGAGAAGCCAAGGAGACTCGGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080729.1-173s1c1
Sequence:CCGGGCCACACCCACCACGCAGAATCTCGAGATTCTGCGTGGTGGGTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080729.1-253s1c1
Sequence:CCGGGAGTTGGACAGGGACTTGAATCTCGAGATTCAAGTCCCTGTCCAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080729.1-366s1c1
Sequence:CCGGCGTCCCACTTTACCACAACCACTCGAGTGGTTGTGGTAAAGTGGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080729.1-378s1c1
Sequence:CCGGCCACAACCAGACGGTCTTCTACTCGAGTAGAAGACCGTCTGGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080729
IL25 MISSION shRNA shRNA Plasmid DNA
interleukin 25
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080729.1-458s1c1
Sequence:CCGGTCTACCGAGTCTCCTTGGCTTCTCGAGAAGCCAAGGAGACTCGGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080729.1-173s1c1
Sequence:CCGGGCCACACCCACCACGCAGAATCTCGAGATTCTGCGTGGTGGGTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080729.1-253s1c1
Sequence:CCGGGAGTTGGACAGGGACTTGAATCTCGAGATTCAAGTCCCTGTCCAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080729.1-366s1c1
Sequence:CCGGCGTCCCACTTTACCACAACCACTCGAGTGGTTGTGGTAAAGTGGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080729.1-378s1c1
Sequence:CCGGCCACAACCAGACGGTCTTCTACTCGAGTAGAAGACCGTCTGGTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080729
IL25 MISSION shRNA Lentiviral Transduction Particles
interleukin 25
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080729.1-458s1c1
Sequence:CCGGTCTACCGAGTCTCCTTGGCTTCTCGAGAAGCCAAGGAGACTCGGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080729.1-173s1c1
Sequence:CCGGGCCACACCCACCACGCAGAATCTCGAGATTCTGCGTGGTGGGTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080729.1-253s1c1
Sequence:CCGGGAGTTGGACAGGGACTTGAATCTCGAGATTCAAGTCCCTGTCCAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080729.1-366s1c1
Sequence:CCGGCGTCCCACTTTACCACAACCACTCGAGTGGTTGTGGTAAAGTGGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080729.1-378s1c1
Sequence:CCGGCCACAACCAGACGGTCTTCTACTCGAGTAGAAGACCGTCTGGTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022789
IL25 MISSION shRNA Bacterial Glycerol Stock
interleukin 25
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022789.2-712s1c1
Sequence:CCGGCCACAACCAGACTGTCTTCTACTCGAGTAGAAGACAGTCTGGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022789.2-792s1c1
Sequence:CCGGTGTACCGTGTTTCCTTAGCTTCTCGAGAAGCTAAGGAAACACGGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022789.2-582s1c1
Sequence:CCGGGATATGAGTTGGACAGAGACTCTCGAGAGTCTCTGTCCAACTCATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022789.2-339s1c1
Sequence:CCGGACAGTTCTCTCATTAGCCTTTCTCGAGAAAGGCTAATGAGAGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022789.2-378s1c1
Sequence:CCGGTCTTGGCAATGGTCATGGGAACTCGAGTTCCCATGACCATTGCCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022789.2-1165s21c1
Sequence:CCGGACAGGCACTTTCTAGATATTTCTCGAGAAATATCTAGAAAGTGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022789.2-527s21c1
Sequence:CCGGTCCTGTAGGGCCAGTGAAGATCTCGAGATCTTCACTGGCCCTACAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022789
IL25 MISSION shRNA shRNA Plasmid DNA
interleukin 25
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022789.2-712s1c1
Sequence:CCGGCCACAACCAGACTGTCTTCTACTCGAGTAGAAGACAGTCTGGTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022789.2-792s1c1
Sequence:CCGGTGTACCGTGTTTCCTTAGCTTCTCGAGAAGCTAAGGAAACACGGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022789.2-582s1c1
Sequence:CCGGGATATGAGTTGGACAGAGACTCTCGAGAGTCTCTGTCCAACTCATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022789.2-339s1c1
Sequence:CCGGACAGTTCTCTCATTAGCCTTTCTCGAGAAAGGCTAATGAGAGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022789.2-378s1c1
Sequence:CCGGTCTTGGCAATGGTCATGGGAACTCGAGTTCCCATGACCATTGCCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022789.2-1165s21c1
Sequence:CCGGACAGGCACTTTCTAGATATTTCTCGAGAAATATCTAGAAAGTGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022789.2-527s21c1
Sequence:CCGGTCCTGTAGGGCCAGTGAAGATCTCGAGATCTTCACTGGCCCTACAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022789
IL25 MISSION shRNA Lentiviral Transduction Particles
interleukin 25
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022789.2-712s1c1
Sequence:CCGGCCACAACCAGACTGTCTTCTACTCGAGTAGAAGACAGTCTGGTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022789.2-792s1c1
Sequence:CCGGTGTACCGTGTTTCCTTAGCTTCTCGAGAAGCTAAGGAAACACGGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022789.2-582s1c1
Sequence:CCGGGATATGAGTTGGACAGAGACTCTCGAGAGTCTCTGTCCAACTCATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022789.2-339s1c1
Sequence:CCGGACAGTTCTCTCATTAGCCTTTCTCGAGAAAGGCTAATGAGAGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022789.2-378s1c1
Sequence:CCGGTCTTGGCAATGGTCATGGGAACTCGAGTTCCCATGACCATTGCCAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022789.2-1165s21c1
Sequence:CCGGACAGGCACTTTCTAGATATTTCTCGAGAAATATCTAGAAAGTGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022789.2-527s21c1
Sequence:CCGGTCCTGTAGGGCCAGTGAAGATCTCGAGATCTTCACTGGCCCTACAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)