EMAIL THIS PAGE TO A FRIEND

IL26

interleukin 26

50 Gene Product Result for
Synonyms: AK155 IL-26
UniProtKB ID: Q9NPH9
Gene ID:
Human(55801) Summary: This gene was identified by its overexpression specifically in herpesvirus samimiri-transformed T cells. The encoded protein is a member of the IL10 family of cytokines. It is a secreted protein and may function as a homodimer. This protein is thought to contribute to the transformed phenotype of T cells after infection by herpesvirus samimiri. [provided by RefSeq, Jul 2008]
naked mole-rat(101706700) interleukin 26
sheep(101107268) interleukin 26
Zebrafish(553971) interleukin 26
cow(782075) interleukin 26
domestic cat(101094939) interleukin 26
chicken(101665763) interleukin 26
chicken(101751928) interleukin 26
dog(608923) interleukin 26
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018402 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018402 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018402 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057251 MISSION® esiRNA esiRNA human IL26 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018402 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351897 predicted 661
2 SASI_Hs01_00135674 predicted 600
3 SASI_Hs01_00135675 predicted 792
4 SASI_Hs01_00135676 predicted 694
5 SASI_Hs01_00135677 predicted 798
6 SASI_Hs01_00135678 predicted 490
7 SASI_Hs01_00135679 predicted 683
8 SASI_Hs02_00351898 predicted 534
9 SASI_Hs01_00135681 predicted 789
10 SASI_Hs01_00135682 predicted 712
11 SASI_Hs01_00135680 predicted 611
12 SASI_Hs01_00135683 predicted 714
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018402
IL26 MISSION shRNA Bacterial Glycerol Stock
interleukin 26
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018402.1-155s21c1
Sequence:CCGGAGCTGTTGACGCTCTCTATATCTCGAGATATAGAGAGCGTCAACAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018402.1-796s21c1
Sequence:CCGGAGTACATTGTGTCAACTTAATCTCGAGATTAAGTTGACACAATGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018402.1-489s1c1
Sequence:CCGGGCCATCAGTGAACTGGATATTCTCGAGAATATCCAGTTCACTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018402.1-183s1c1
Sequence:CCGGGCATGGCTCAAAGCAACGATTCTCGAGAATCGTTGCTTTGAGCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018402.1-351s1c1
Sequence:CCGGCGCTTTGTGGAGGACTTTCATCTCGAGATGAAAGTCCTCCACAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018402.1-380s1c1
Sequence:CCGGGCAGAAATTGAGCCACTGTATCTCGAGATACAGTGGCTCAATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018402.1-199s1c1
Sequence:CCGGCGATTCCAGAAGACCGCATAACTCGAGTTATGCGGTCTTCTGGAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018402
IL26 MISSION shRNA shRNA Plasmid DNA
interleukin 26
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018402.1-155s21c1
Sequence:CCGGAGCTGTTGACGCTCTCTATATCTCGAGATATAGAGAGCGTCAACAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018402.1-796s21c1
Sequence:CCGGAGTACATTGTGTCAACTTAATCTCGAGATTAAGTTGACACAATGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018402.1-489s1c1
Sequence:CCGGGCCATCAGTGAACTGGATATTCTCGAGAATATCCAGTTCACTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018402.1-183s1c1
Sequence:CCGGGCATGGCTCAAAGCAACGATTCTCGAGAATCGTTGCTTTGAGCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018402.1-351s1c1
Sequence:CCGGCGCTTTGTGGAGGACTTTCATCTCGAGATGAAAGTCCTCCACAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018402.1-380s1c1
Sequence:CCGGGCAGAAATTGAGCCACTGTATCTCGAGATACAGTGGCTCAATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018402.1-199s1c1
Sequence:CCGGCGATTCCAGAAGACCGCATAACTCGAGTTATGCGGTCTTCTGGAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018402
IL26 MISSION shRNA Lentiviral Transduction Particles
interleukin 26
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018402.1-155s21c1
Sequence:CCGGAGCTGTTGACGCTCTCTATATCTCGAGATATAGAGAGCGTCAACAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018402.1-796s21c1
Sequence:CCGGAGTACATTGTGTCAACTTAATCTCGAGATTAAGTTGACACAATGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018402.1-489s1c1
Sequence:CCGGGCCATCAGTGAACTGGATATTCTCGAGAATATCCAGTTCACTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018402.1-183s1c1
Sequence:CCGGGCATGGCTCAAAGCAACGATTCTCGAGAATCGTTGCTTTGAGCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018402.1-351s1c1
Sequence:CCGGCGCTTTGTGGAGGACTTTCATCTCGAGATGAAAGTCCTCCACAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018402.1-380s1c1
Sequence:CCGGGCAGAAATTGAGCCACTGTATCTCGAGATACAGTGGCTCAATTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018402.1-199s1c1
Sequence:CCGGCGATTCCAGAAGACCGCATAACTCGAGTTATGCGGTCTTCTGGAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)