EMAIL THIS PAGE TO A FRIEND

IL27

interleukin 27

75 Gene Product Result for
Synonyms: IL-27 IL-27A IL27A IL27p28 IL30 p28
UniProtKB ID: Q8NEV9, A0N0L2, Q6P676
Gene ID:
Human(246778) Summary: The protein encoded by this gene is one of the subunits of a heterodimeric cytokine complex. This protein is related to interleukin 12A (IL12A). It interacts with Epstein-Barr virus induced gene 3 (EBI3), a protein similar to interleukin 12B (IL12B), and forms a complex that has been shown to drive rapid expansion of naive but not memory CD4(+) T cells. The complex is also found to synergize strongly with interleukin 12 to trigger interferon gamma (IFNG) production of naive CD4(+) T cells. The biological effects of this cytokine are mediated by the class I cytokine receptor (WSX1/TCRR). [provided by RefSeq, Jul 2008]
Mouse(246779) interleukin 27
Rat(365368) interleukin 27
domestic cat(101093822) interleukin 27
cow(614927) interleukin 27
dog(607880) interleukin 27
sheep(101122495) interleukin 27
naked mole-rat(101724119) interleukin 27
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145659 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145659 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145659 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145636 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145636 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145636 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU153391 MISSION® esiRNA esiRNA targeting mouse Il27 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145659 Rosetta Predictions human pricing
XM_344962 Rosetta Predictions rat pricing
NM_145636 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365282 predicted 272
2 SASI_Hs01_00119327 predicted 817
3 SASI_Hs01_00119328 predicted 206
4 SASI_Hs01_00119329 predicted 280
5 SASI_Hs01_00119331 predicted 207
6 SASI_Hs01_00119333 predicted 210
7 SASI_Hs01_00119334 predicted 778
8 SASI_Hs01_00119335 predicted 281
9 SASI_Hs01_00119336 predicted 217
10 SASI_Hs02_00365283 predicted 220
11 SASI_Hs01_00119330 predicted 798
12 SASI_Hs01_00119332 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344962 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397801 predicted 359
2 SASI_Rn02_00397802 predicted 197
3 SASI_Rn02_00397803 predicted 353
4 SASI_Rn02_00397804 predicted 456
5 SASI_Rn02_00397805 predicted 446
6 SASI_Rn02_00397806 predicted 287
7 SASI_Rn02_00397807 predicted 466
8 SASI_Rn02_00397808 predicted 270
9 SASI_Rn02_00397809 predicted 555
10 SASI_Rn02_00397810 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145636 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143714 predicted 231
2 SASI_Mm01_00143715 predicted 245
3 SASI_Mm01_00143716 predicted 246
4 SASI_Mm01_00143717 predicted 242
5 SASI_Mm01_00143718 predicted 244
6 SASI_Mm01_00143720 predicted 233
7 SASI_Mm01_00143722 predicted 29
8 SASI_Mm02_00341228 predicted 296
9 SASI_Mm01_00143723 predicted 169
10 SASI_Mm02_00341229 predicted 156
11 SASI_Mm01_00143719 predicted 238
12 SASI_Mm01_00143721 predicted 190
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145659
IL27 MISSION shRNA Bacterial Glycerol Stock
interleukin 27
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145659.2-136s1c1
Sequence:CCGGGAGTTCACAGTCAGCCTGCATCTCGAGATGCAGGCTGACTGTGAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145659.2-319s1c1
Sequence:CCGGTGCTTCATCTCCACCACGCTTCTCGAGAAGCGTGGTGGAGATGAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145659.2-454s1c1
Sequence:CCGGCGCTTCCAGGTGCTGGCTGCACTCGAGTGCAGCCAGCACCTGGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145659.2-36s1c1
Sequence:CCGGCAGCCTGTTGCTGCTTCCCTTCTCGAGAAGGGAAGCAGCAACAGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145659.2-195s1c1
Sequence:CCGGCCACCGCTTTGCGGAATCTCACTCGAGTGAGATTCCGCAAAGCGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145659.3-646s21c1
Sequence:CCGGACTCCTTGGAGCTCGTCTTATCTCGAGATAAGACGAGCTCCAAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145659.3-832s21c1
Sequence:CCGGCATCATCAGCCTTGGACAAGGCTCGAGCCTTGTCCAAGGCTGATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145659.3-285s21c1
Sequence:CCGGCCTGATGTTTCCCTGACCTTCCTCGAGGAAGGTCAGGGAAACATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145659.3-794s21c1
Sequence:CCGGACTTTAGGACTGGAGTCTTGGCTCGAGCCAAGACTCCAGTCCTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145659
IL27 MISSION shRNA shRNA Plasmid DNA
interleukin 27
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145659.2-136s1c1
Sequence:CCGGGAGTTCACAGTCAGCCTGCATCTCGAGATGCAGGCTGACTGTGAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145659.2-319s1c1
Sequence:CCGGTGCTTCATCTCCACCACGCTTCTCGAGAAGCGTGGTGGAGATGAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145659.2-454s1c1
Sequence:CCGGCGCTTCCAGGTGCTGGCTGCACTCGAGTGCAGCCAGCACCTGGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145659.2-36s1c1
Sequence:CCGGCAGCCTGTTGCTGCTTCCCTTCTCGAGAAGGGAAGCAGCAACAGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145659.2-195s1c1
Sequence:CCGGCCACCGCTTTGCGGAATCTCACTCGAGTGAGATTCCGCAAAGCGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145659.3-646s21c1
Sequence:CCGGACTCCTTGGAGCTCGTCTTATCTCGAGATAAGACGAGCTCCAAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145659.3-832s21c1
Sequence:CCGGCATCATCAGCCTTGGACAAGGCTCGAGCCTTGTCCAAGGCTGATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145659.3-285s21c1
Sequence:CCGGCCTGATGTTTCCCTGACCTTCCTCGAGGAAGGTCAGGGAAACATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145659.3-794s21c1
Sequence:CCGGACTTTAGGACTGGAGTCTTGGCTCGAGCCAAGACTCCAGTCCTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145659
IL27 MISSION shRNA Lentiviral Transduction Particles
interleukin 27
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145659.2-136s1c1
Sequence:CCGGGAGTTCACAGTCAGCCTGCATCTCGAGATGCAGGCTGACTGTGAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145659.2-319s1c1
Sequence:CCGGTGCTTCATCTCCACCACGCTTCTCGAGAAGCGTGGTGGAGATGAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145659.2-454s1c1
Sequence:CCGGCGCTTCCAGGTGCTGGCTGCACTCGAGTGCAGCCAGCACCTGGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145659.2-36s1c1
Sequence:CCGGCAGCCTGTTGCTGCTTCCCTTCTCGAGAAGGGAAGCAGCAACAGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145659.2-195s1c1
Sequence:CCGGCCACCGCTTTGCGGAATCTCACTCGAGTGAGATTCCGCAAAGCGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145659.3-646s21c1
Sequence:CCGGACTCCTTGGAGCTCGTCTTATCTCGAGATAAGACGAGCTCCAAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145659.3-832s21c1
Sequence:CCGGCATCATCAGCCTTGGACAAGGCTCGAGCCTTGTCCAAGGCTGATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145659.3-285s21c1
Sequence:CCGGCCTGATGTTTCCCTGACCTTCCTCGAGGAAGGTCAGGGAAACATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145659.3-794s21c1
Sequence:CCGGACTTTAGGACTGGAGTCTTGGCTCGAGCCAAGACTCCAGTCCTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145636
IL27 MISSION shRNA Bacterial Glycerol Stock
interleukin 27
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145636.1-239s1c1
Sequence:CCGGGATACCATCTTCCCAATGTTTCTCGAGAAACATTGGGAAGATGGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145636.1-56s1c1
Sequence:CCGGTGCTTCTGGTACAAGCTGGTTCTCGAGAACCAGCTTGTACCAGAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145636.1-172s1c1
Sequence:CCGGCAGGGCTATGTCCACAGCTTTCTCGAGAAAGCTGTGGACATAGCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145636.1-249s1c1
Sequence:CCGGTCCCAATGTTTCCCTGACTTTCTCGAGAAAGTCAGGGAAACATTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145636.1-459s1c1
Sequence:CCGGTGCAGGATTCAAATGTTCAAACTCGAGTTTGAACATTTGAATCCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145636
IL27 MISSION shRNA shRNA Plasmid DNA
interleukin 27
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145636.1-239s1c1
Sequence:CCGGGATACCATCTTCCCAATGTTTCTCGAGAAACATTGGGAAGATGGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145636.1-56s1c1
Sequence:CCGGTGCTTCTGGTACAAGCTGGTTCTCGAGAACCAGCTTGTACCAGAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145636.1-172s1c1
Sequence:CCGGCAGGGCTATGTCCACAGCTTTCTCGAGAAAGCTGTGGACATAGCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145636.1-249s1c1
Sequence:CCGGTCCCAATGTTTCCCTGACTTTCTCGAGAAAGTCAGGGAAACATTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145636.1-459s1c1
Sequence:CCGGTGCAGGATTCAAATGTTCAAACTCGAGTTTGAACATTTGAATCCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145636
IL27 MISSION shRNA Lentiviral Transduction Particles
interleukin 27
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145636.1-239s1c1
Sequence:CCGGGATACCATCTTCCCAATGTTTCTCGAGAAACATTGGGAAGATGGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145636.1-56s1c1
Sequence:CCGGTGCTTCTGGTACAAGCTGGTTCTCGAGAACCAGCTTGTACCAGAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145636.1-172s1c1
Sequence:CCGGCAGGGCTATGTCCACAGCTTTCTCGAGAAAGCTGTGGACATAGCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145636.1-249s1c1
Sequence:CCGGTCCCAATGTTTCCCTGACTTTCTCGAGAAAGTCAGGGAAACATTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145636.1-459s1c1
Sequence:CCGGTGCAGGATTCAAATGTTCAAACTCGAGTTTGAACATTTGAATCCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)