EMAIL THIS PAGE TO A FRIEND

IL27RA

interleukin 27 receptor, alpha

73 Gene Product Result for
Synonyms: CRL1 IL-27RA IL27R TCCR WSX1 zcytor1
UniProtKB ID: Q6UWB1, A0N0L1, O60624
Gene ID:
Human(9466) Summary: In mice, CD4+ helper T-cells differentiate into type 1 (Th1) cells, which are critical for cell-mediated immunity, predominantly under the influence of IL12. Also, IL4 influences their differentiation into type 2 (Th2) cells, which are critical for most antibody responses. Mice deficient in these cytokines, their receptors, or associated transcription factors have impaired, but are not absent of, Th1 or Th2 immune responses. This gene encodes a protein which is similar to the mouse T-cell cytokine receptor Tccr at the amino acid level, and is predicted to be a glycosylated transmembrane protein. [provided by RefSeq, Jul 2008]
Mouse(50931) interleukin 27 receptor, alpha
Rat(288905) interleukin 27 receptor, alpha
domestic guinea pig(100723356) interleukin 27 receptor, alpha
naked mole-rat(101699944) interleukin 27 receptor, alpha
sheep(101102232) interleukin 27 receptor, alpha
dog(484907) interleukin 27 receptor, alpha
cow(514529) interleukin 27 receptor, alpha
domestic cat(101089988) interleukin 27 receptor, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004843 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004843 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004843 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016671 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016671 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016671 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051741 MISSION® esiRNA esiRNA human IL27RA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004843 Rosetta Predictions human pricing
NM_001105943 Rosetta Predictions rat pricing
NM_016671 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051688 predicted 1002
2 SASI_Hs01_00051689 predicted 1771
3 SASI_Hs01_00051691 predicted 1196
4 SASI_Hs01_00051692 predicted 1547
5 SASI_Hs01_00051693 predicted 1164
6 SASI_Hs01_00051694 predicted 617
7 SASI_Hs01_00051695 predicted 543
8 SASI_Hs01_00051696 predicted 708
9 SASI_Hs02_00338426 predicted 1919
10 SASI_Hs02_00338427 predicted 873
11 SASI_Hs01_00051690 predicted 1246
12 SASI_Hs01_00051697 predicted 1843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105943 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214072 predicted 341
2 SASI_Rn02_00214073 predicted 238
3 SASI_Rn02_00214074 predicted 1265
4 SASI_Rn02_00214075 predicted 581
5 SASI_Rn02_00214076 predicted 1460
6 SASI_Rn02_00214077 predicted 1398
7 SASI_Rn02_00214078 predicted 746
8 SASI_Rn02_00214079 predicted 247
9 SASI_Rn02_00214080 predicted 1286
10 SASI_Rn02_00214081 predicted 1209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162728 predicted 248
2 SASI_Mm01_00162729 predicted 1528
3 SASI_Mm01_00162732 predicted 232
4 SASI_Mm01_00162733 predicted 801
5 SASI_Mm02_00323300 predicted 1048
6 SASI_Mm02_00323301 predicted 525
7 SASI_Mm01_00162734 predicted 1936
8 SASI_Mm02_00323302 predicted 1201
9 SASI_Mm01_00162735 predicted 303
10 SASI_Mm02_00323303 predicted 831
11 SASI_Mm01_00162727 predicted 1029
12 SASI_Mm01_00162730 predicted 378
13 SASI_Mm01_00162731 predicted 417
14 SASI_Mm01_00162736 predicted 1218
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004843
IL27RA MISSION shRNA Bacterial Glycerol Stock
interleukin 27 receptor, alpha
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004843.2-1951s21c1
Sequence:CCGGGATAACACCCTGAGGTGGAAACTCGAGTTTCCACCTCAGGGTGTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004843.2-2048s21c1
Sequence:CCGGGCTACCACCTAAGGCACAAAGCTCGAGCTTTGTGCCTTAGGTGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004843.2-2688s21c1
Sequence:CCGGTCACTTAGAGCTAGGAGTTTGCTCGAGCAAACTCCTAGCTCTAAGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004843.2-1018s1c1
Sequence:CCGGGCCACTGGCTACAAAGTGTATCTCGAGATACACTTTGTAGCCAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004843.2-2083s1c1
Sequence:CCGGGTCTGGGAGAAAGTTCCTGATCTCGAGATCAGGAACTTTCTCCCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004843.2-1550s1c1
Sequence:CCGGGTGCTCTGTTACCAGGGAATTCTCGAGAATTCCCTGGTAACAGAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004843.2-780s1c1
Sequence:CCGGCGTGAACCTAGAAACCCAAATCTCGAGATTTGGGTTTCTAGGTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004843.2-891s1c1
Sequence:CCGGGCCATCTCATAAAGTTCTGATCTCGAGATCAGAACTTTATGAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004843
IL27RA MISSION shRNA shRNA Plasmid DNA
interleukin 27 receptor, alpha
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004843.2-1951s21c1
Sequence:CCGGGATAACACCCTGAGGTGGAAACTCGAGTTTCCACCTCAGGGTGTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004843.2-2048s21c1
Sequence:CCGGGCTACCACCTAAGGCACAAAGCTCGAGCTTTGTGCCTTAGGTGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004843.2-2688s21c1
Sequence:CCGGTCACTTAGAGCTAGGAGTTTGCTCGAGCAAACTCCTAGCTCTAAGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004843.2-1018s1c1
Sequence:CCGGGCCACTGGCTACAAAGTGTATCTCGAGATACACTTTGTAGCCAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004843.2-2083s1c1
Sequence:CCGGGTCTGGGAGAAAGTTCCTGATCTCGAGATCAGGAACTTTCTCCCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004843.2-1550s1c1
Sequence:CCGGGTGCTCTGTTACCAGGGAATTCTCGAGAATTCCCTGGTAACAGAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004843.2-780s1c1
Sequence:CCGGCGTGAACCTAGAAACCCAAATCTCGAGATTTGGGTTTCTAGGTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004843.2-891s1c1
Sequence:CCGGGCCATCTCATAAAGTTCTGATCTCGAGATCAGAACTTTATGAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004843
IL27RA MISSION shRNA Lentiviral Transduction Particles
interleukin 27 receptor, alpha
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004843.2-1951s21c1
Sequence:CCGGGATAACACCCTGAGGTGGAAACTCGAGTTTCCACCTCAGGGTGTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004843.2-2048s21c1
Sequence:CCGGGCTACCACCTAAGGCACAAAGCTCGAGCTTTGTGCCTTAGGTGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004843.2-2688s21c1
Sequence:CCGGTCACTTAGAGCTAGGAGTTTGCTCGAGCAAACTCCTAGCTCTAAGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004843.2-1018s1c1
Sequence:CCGGGCCACTGGCTACAAAGTGTATCTCGAGATACACTTTGTAGCCAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004843.2-2083s1c1
Sequence:CCGGGTCTGGGAGAAAGTTCCTGATCTCGAGATCAGGAACTTTCTCCCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004843.2-1550s1c1
Sequence:CCGGGTGCTCTGTTACCAGGGAATTCTCGAGAATTCCCTGGTAACAGAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004843.2-780s1c1
Sequence:CCGGCGTGAACCTAGAAACCCAAATCTCGAGATTTGGGTTTCTAGGTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004843.2-891s1c1
Sequence:CCGGGCCATCTCATAAAGTTCTGATCTCGAGATCAGAACTTTATGAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016671
IL27RA MISSION shRNA Bacterial Glycerol Stock
interleukin 27 receptor, alpha
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016671.2-1736s1c1
Sequence:CCGGGCAACCTTACATCAAGGAGGTCTCGAGACCTCCTTGATGTAAGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016671.2-708s1c1
Sequence:CCGGCCATTCTTAGATCCTGAAGATCTCGAGATCTTCAGGATCTAAGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016671.2-1191s1c1
Sequence:CCGGCGAATTACAGTGACTGCAGTACTCGAGTACTGCAGTCACTGTAATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016671.2-1551s1c1
Sequence:CCGGGATAATAGGATCAGGTGGAAACTCGAGTTTCCACCTGATCCTATTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016671.2-432s1c1
Sequence:CCGGCAAGTGGATATTTCTGAGGAACTCGAGTTCCTCAGAAATATCCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016671
IL27RA MISSION shRNA shRNA Plasmid DNA
interleukin 27 receptor, alpha
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016671.2-1736s1c1
Sequence:CCGGGCAACCTTACATCAAGGAGGTCTCGAGACCTCCTTGATGTAAGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016671.2-708s1c1
Sequence:CCGGCCATTCTTAGATCCTGAAGATCTCGAGATCTTCAGGATCTAAGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016671.2-1191s1c1
Sequence:CCGGCGAATTACAGTGACTGCAGTACTCGAGTACTGCAGTCACTGTAATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016671.2-1551s1c1
Sequence:CCGGGATAATAGGATCAGGTGGAAACTCGAGTTTCCACCTGATCCTATTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016671.2-432s1c1
Sequence:CCGGCAAGTGGATATTTCTGAGGAACTCGAGTTCCTCAGAAATATCCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016671
IL27RA MISSION shRNA Lentiviral Transduction Particles
interleukin 27 receptor, alpha
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016671.2-1736s1c1
Sequence:CCGGGCAACCTTACATCAAGGAGGTCTCGAGACCTCCTTGATGTAAGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016671.2-708s1c1
Sequence:CCGGCCATTCTTAGATCCTGAAGATCTCGAGATCTTCAGGATCTAAGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016671.2-1191s1c1
Sequence:CCGGCGAATTACAGTGACTGCAGTACTCGAGTACTGCAGTCACTGTAATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016671.2-1551s1c1
Sequence:CCGGGATAATAGGATCAGGTGGAAACTCGAGTTTCCACCTGATCCTATTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016671.2-432s1c1
Sequence:CCGGCAAGTGGATATTTCTGAGGAACTCGAGTTCCTCAGAAATATCCACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)