EMAIL THIS PAGE TO A FRIEND

IL2

interleukin 2

130 Gene Product Result for
Synonyms: IL-2 TCGF lymphokine
UniProtKB ID: P60568, P01585
Gene ID:
Human(3558) Summary: The protein encoded by this gene is a secreted cytokine that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine is a heterotrimeric protein complex whose gamma chain is also shared by interleukin 4 (IL4) and interleukin 7 (IL7). The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq, Jul 2008]
Mouse(16183) interleukin 2
Rat(116562) interleukin 2
chicken(373958) interleukin 2
cow(280822) interleukin 2
Horse(100034204) interleukin 2
domestic cat(751114) interleukin 2
dog(403989) interleukin 2
sheep(443401) interleukin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW22461F Anti-Interleukin-2 antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, western blot pricing
I8398 Anti-Interleukin-2 antibody produced in goat IgG fraction of antiserum, lyophilized powder mouse
neutralization, western blot pricing
I8273 Anti-Interleukin-2 antibody produced in goat IgG fraction of antiserum, lyophilized powder human
neutralization, western blot pricing
I7401 Anti-Interleukin-2 antibody produced in goat affinity isolated antibody, lyophilized powder human
immunocytochemistry, neutralization, western blot pricing
I7784 Anti-Interleukin-2 antibody produced in goat affinity isolated antibody, lyophilized powder mouse, rat
neutralization, western blot pricing
WH0003558M3 Monoclonal Anti-IL2 antibody produced in mouse clone 3C8, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1403970 Monoclonal Anti-IL2, (C-terminal) antibody produced in mouse clone 1C5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
I6784 Monoclonal Anti-Interleukin-2 antibody produced in mouse clone 5334, purified immunoglobulin, lyophilized powder human
flow cytometry, immunohistochemistry, neutralization pricing
I6909 Monoclonal Anti-Interleukin-2 antibody produced in mouse clone 5355, purified immunoglobulin, lyophilized powder human
ELISA, immunohistochemistry pricing
F5900 Monoclonal Anti-Interleukin-2−Carboxyfluorescein antibody produced in mouse clone 5334, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
P6847 Monoclonal Anti-Interleukin-2−R-Phycoerythrin antibody produced in mouse clone 5334, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
S8442 SU 5416 ≥98% (HPLC) human, mouse pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T3434 Tyrphostin AG 490 solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000586 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000586 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000586 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008366 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008366 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008366 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144161 MISSION® esiRNA esiRNA human IL2 (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
MABF334 Anti-IL-2 (human) Antibody, FITC, clone MQ1-17H12 Anti-IL-2 (human) Antibody, FITC, clone MQ1-17H12 is a highly specific rat monoclonal antibody, that targets IL-2 & has been tested in Flow Cytometry, IHC & IP. pricing
MABF335 Anti-IL-2 (human) Antibody, PE, clone MQ1-17H12 Anti-IL-2 (human) Antibody, PE, clone MQ1-17H12 is a highly specific rat monoclonal antibody, that targets IL-2 & has been tested in Flow Cytometry, IHC & IP. pricing
MABF150C Anti-IL-2 (mouse), APC, clone JES6-5H4 Antibody This rat monoclonal Anti-IL-2 Antibody (mouse), APC, clone JES6-5H4, Cat. No. MABF1505 is validated for use in Flow Cytometry, for the detection of IL-2. pricing
MABF150D Anti-IL-2 (mouse), clone JES6-5H4, biotin conjugate Antibody This rat monoclonal Anti-IL-2 Antibody (mouse), clone JES6-5H4, biotin conjugate, Cat. No. MABF1507 is validated for use in Flow Cytometry, for the detection of IL-2. pricing
MABF150E Anti-IL-2 (mouse), PE, clone JES6-5H4 Antibody This rat monoclonal Anti-IL-2 Antibody (mouse), PE, clone JES6-5H4, Cat. No. MABF1509 is validated for use in Flow Cytometry, for the detection of IL-2. pricing
04-1584 Anti-Interleukin-2 (IL-2) Antibody, clone 3F9 Detect Interleukin-2 (IL-2) using this Anti-Interleukin-2 (IL-2) Antibody, clone 3F9 validated for use in WB. pricing
IL002 Interleukin-2 Protein, Recombinant human The recombinant human Interleukin-2 protein (or IL-2 protein) is a potent lymphoid cell growth factor which exerts its biological activity primarily on T cells. pricing
FCMAB221PE Milli-Mark™ Anti-Interleukin-2-PE Antibody, Clone S4B6-1 Milli-Mark Anti-Interleukin-2-PE Antibody, Clone S4B6-1 detects level of Interleukin-2 & has been published & validated for use in FC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000586 Rosetta Predictions human pricing
NM_053836 Rosetta Predictions rat pricing
NM_008366 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302850 predicted 279
2 SASI_Hs02_00302851 predicted 277
3 SASI_Hs02_00302852 predicted 293
4 SASI_Hs01_00138458 predicted 226
5 SASI_Hs02_00302853 predicted 316
6 SASI_Hs02_00302854 predicted 311
7 SASI_Hs02_00302855 predicted 266
8 SASI_Hs01_00138460 predicted 277
9 SASI_Hs02_00302856 predicted 219
10 SASI_Hs01_00138463 predicted 223
11 SASI_Hs01_00138454 predicted 380
12 SASI_Hs01_00138455 predicted 323
13 SASI_Hs01_00138456 predicted 309
14 SASI_Hs01_00138457 predicted 396
15 SASI_Hs01_00138459 predicted 315
16 SASI_Hs01_00138461 predicted 352
17 SASI_Hs01_00138462 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053836 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266682 predicted 208
2 SASI_Rn01_00111102 predicted 274
3 SASI_Rn02_00266683 predicted 216
4 SASI_Rn01_00111103 predicted 262
5 SASI_Rn01_00111104 predicted 214
6 SASI_Rn01_00111105 predicted 216
7 SASI_Rn01_00111106 predicted 275
8 SASI_Rn01_00111108 predicted 204
9 SASI_Rn01_00111109 predicted 263
10 SASI_Rn01_00111110 predicted 280
11 SASI_Rn01_00111101 predicted 280
12 SASI_Rn01_00111107 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008366 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139797 predicted 397
2 SASI_Mm01_00139798 predicted 436
3 SASI_Mm01_00139799 predicted 672
4 SASI_Mm01_00139800 predicted 554
5 SASI_Mm01_00139801 predicted 658
6 SASI_Mm01_00139802 predicted 511
7 SASI_Mm01_00139803 predicted 393
8 SASI_Mm01_00139804 predicted 449
9 SASI_Mm01_00139805 predicted 618
10 SASI_Mm01_00139806 predicted 506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000586
IL2 MISSION shRNA Bacterial Glycerol Stock
interleukin 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000586.2-599s1c1
Sequence:CCGGCCAGGGACTTAATCAGCAATACTCGAGTATTGCTGATTAAGTCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000586.2-407s1c1
Sequence:CCGGTGCTGGATTTACAGATGATTTCTCGAGAAATCATCTGTAAATCCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000586.2-561s1c1
Sequence:CCGGGCTAAATTTAGCTCAAAGCAACTCGAGTTGCTTTGAGCTAAATTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000586.2-676s1c1
Sequence:CCGGGCTGATGAGACAGCAACCATTCTCGAGAATGGTTGCTGTCTCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000586.2-734s1c1
Sequence:CCGGGCATCATCTCAACACTGACTTCTCGAGAAGTCAGTGTTGAGATGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000586.3-605s21c1
Sequence:CCGGGCTACCTATTGTAACTATTATCTCGAGATAATAGTTACAATAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000586.3-146s21c1
Sequence:CCGGCAGCTACAACTGGAGCATTTACTCGAGTAAATGCTCCAGTTGTAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000586.3-541s21c1
Sequence:CCGGACATATCAGGCCTTCTATTTACTCGAGTAAATAGAAGGCCTGATATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000586
IL2 MISSION shRNA shRNA Plasmid DNA
interleukin 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000586.2-599s1c1
Sequence:CCGGCCAGGGACTTAATCAGCAATACTCGAGTATTGCTGATTAAGTCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000586.2-407s1c1
Sequence:CCGGTGCTGGATTTACAGATGATTTCTCGAGAAATCATCTGTAAATCCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000586.2-561s1c1
Sequence:CCGGGCTAAATTTAGCTCAAAGCAACTCGAGTTGCTTTGAGCTAAATTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000586.2-676s1c1
Sequence:CCGGGCTGATGAGACAGCAACCATTCTCGAGAATGGTTGCTGTCTCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000586.2-734s1c1
Sequence:CCGGGCATCATCTCAACACTGACTTCTCGAGAAGTCAGTGTTGAGATGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000586.3-605s21c1
Sequence:CCGGGCTACCTATTGTAACTATTATCTCGAGATAATAGTTACAATAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000586.3-146s21c1
Sequence:CCGGCAGCTACAACTGGAGCATTTACTCGAGTAAATGCTCCAGTTGTAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000586.3-541s21c1
Sequence:CCGGACATATCAGGCCTTCTATTTACTCGAGTAAATAGAAGGCCTGATATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000586
IL2 MISSION shRNA Lentiviral Transduction Particles
interleukin 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000586.2-599s1c1
Sequence:CCGGCCAGGGACTTAATCAGCAATACTCGAGTATTGCTGATTAAGTCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000586.2-407s1c1
Sequence:CCGGTGCTGGATTTACAGATGATTTCTCGAGAAATCATCTGTAAATCCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000586.2-561s1c1
Sequence:CCGGGCTAAATTTAGCTCAAAGCAACTCGAGTTGCTTTGAGCTAAATTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000586.2-676s1c1
Sequence:CCGGGCTGATGAGACAGCAACCATTCTCGAGAATGGTTGCTGTCTCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000586.2-734s1c1
Sequence:CCGGGCATCATCTCAACACTGACTTCTCGAGAAGTCAGTGTTGAGATGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000586.3-605s21c1
Sequence:CCGGGCTACCTATTGTAACTATTATCTCGAGATAATAGTTACAATAGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000586.3-146s21c1
Sequence:CCGGCAGCTACAACTGGAGCATTTACTCGAGTAAATGCTCCAGTTGTAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000586.3-541s21c1
Sequence:CCGGACATATCAGGCCTTCTATTTACTCGAGTAAATAGAAGGCCTGATATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008366
IL2 MISSION shRNA Bacterial Glycerol Stock
interleukin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008366.2-396s1c1
Sequence:CCGGGCTGAGAATTTCATCAGCAATCTCGAGATTGCTGATGAAATTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008366.2-221s1c1
Sequence:CCGGCCTGAGCAGGATGGAGAATTACTCGAGTAATTCTCCATCCTGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008366.2-452s1c1
Sequence:CCGGCAACACATTTGAGTGCCAATTCTCGAGAATTGGCACTCAAATGTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008366.2-536s1c1
Sequence:CCGGCATCTCAACAAGCCCTCAATACTCGAGTATTGAGGGCTTGTTGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008366.2-297s1c1
Sequence:CCGGGCCACAGAATTGAAAGATCTTCTCGAGAAGATCTTTCAATTCTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008366
IL2 MISSION shRNA shRNA Plasmid DNA
interleukin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008366.2-396s1c1
Sequence:CCGGGCTGAGAATTTCATCAGCAATCTCGAGATTGCTGATGAAATTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008366.2-221s1c1
Sequence:CCGGCCTGAGCAGGATGGAGAATTACTCGAGTAATTCTCCATCCTGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008366.2-452s1c1
Sequence:CCGGCAACACATTTGAGTGCCAATTCTCGAGAATTGGCACTCAAATGTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008366.2-536s1c1
Sequence:CCGGCATCTCAACAAGCCCTCAATACTCGAGTATTGAGGGCTTGTTGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008366.2-297s1c1
Sequence:CCGGGCCACAGAATTGAAAGATCTTCTCGAGAAGATCTTTCAATTCTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008366
IL2 MISSION shRNA Lentiviral Transduction Particles
interleukin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008366.2-396s1c1
Sequence:CCGGGCTGAGAATTTCATCAGCAATCTCGAGATTGCTGATGAAATTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008366.2-221s1c1
Sequence:CCGGCCTGAGCAGGATGGAGAATTACTCGAGTAATTCTCCATCCTGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008366.2-452s1c1
Sequence:CCGGCAACACATTTGAGTGCCAATTCTCGAGAATTGGCACTCAAATGTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008366.2-536s1c1
Sequence:CCGGCATCTCAACAAGCCCTCAATACTCGAGTATTGAGGGCTTGTTGAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008366.2-297s1c1
Sequence:CCGGGCCACAGAATTGAAAGATCTTCTCGAGAAGATCTTTCAATTCTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)