EMAIL THIS PAGE TO A FRIEND

IL2RA

interleukin 2 receptor, alpha

142 Gene Product Result for
Synonyms: CD25 IDDM10 IL2R TCGFR
UniProtKB ID: P01589, Q5W007
Gene ID:
Human(3559) Summary: The interleukin 2 (IL2) receptor alpha (IL2RA) and beta (IL2RB) chains, together with the common gamma chain (IL2RG), constitute the high-affinity IL2 receptor. Homodimeric alpha chains (IL2RA) result in low-affinity receptor, while homodimeric beta (IL2RB) chains produce a medium-affinity receptor. Normally an integral-membrane protein, soluble IL2RA has been isolated and determined to result from extracellular proteolyisis. Alternately-spliced IL2RA mRNAs have been isolated, but the significance of each is presently unknown. Mutations in this gene are associated with interleukin 2 receptor alpha deficiency.[provided by RefSeq, Nov 2009]
Mouse(16184) interleukin 2 receptor, alpha chain
Rat(25704) interleukin 2 receptor, alpha
chicken(395294) interleukin 2 receptor, alpha
dog(403870) interleukin 2 receptor, alpha
cow(281861) interleukin 2 receptor, alpha
Horse(100070292) interleukin 2 receptor, alpha
domestic cat(493953) interleukin 2 receptor, alpha
sheep(443435) interleukin 2 receptor, alpha
domestic guinea pig(100715332) interleukin 2 receptor, alpha
naked mole-rat(101696651) interleukin 2 receptor, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500055 Anti-CD25 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP176, affinity isolated antibody human (tested)
immunohistochemistry, western blot pricing
SAB4501537 Anti-IL-2R α antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing
HPA054622 Anti-IL2RA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
I6152 Anti-Interleukin-2 Soluble Receptor α antibody produced in goat affinity isolated antibody, lyophilized powder human
flow cytometry, neutralization, western blot pricing
SAB4504239 Anti-phospho-IL-2R α/CD25 (pSer268) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, western blot pricing
SAB4700360 Monoclonal Anti-CD25 antibody produced in mouse clone MEM-181, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700365 Monoclonal Anti-CD25 antibody produced in mouse clone MEM-140, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB1305503 MONOCLONAL ANTI-CD25 antibody produced in mouse clone 7G7B6, crude ascites, buffered aqueous solution human
western blot pricing
SAB4700361 Monoclonal Anti-CD25-APC antibody produced in mouse clone MEM-181, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700362 Monoclonal Anti-CD25-Biotin antibody produced in mouse clone MEM-181, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700366 Monoclonal Anti-CD25-Biotin antibody produced in mouse clone MEM-140, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700363 Monoclonal Anti-CD25-FITC antibody produced in mouse clone MEM-181, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700364 Monoclonal Anti-CD25-PE antibody produced in mouse clone MEM-181, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700577 Monoclonal Anti-CD25-PE antibody produced in rat clone PC61.5.3, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
WH0003559M4 Monoclonal Anti-IL2RA antibody produced in mouse clone 1D6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
I5652 Monoclonal Anti-Interleukin-2 Soluble Receptor α antibody produced in mouse clone 22722, purified immunoglobulin, lyophilized powder human
immunocytochemistry, immunohistochemistry, neutralization, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000417 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008367 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008367 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008367 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078131 MISSION® esiRNA esiRNA human IL2RA (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
MABF395 Anti-CD25 Antibody (human),clone BC96 This Mouse Monoclonal Antibody Anti-CD25 (human),clone BC96, Cat. No. MABF395 is validated for use in Flow Cytometry for the detection of CD25. pricing
MABF546 Anti-CD25 Antibody (human), PE, clone BC96 This mouse monoclonal antibody Anti-CD25 (human), PE & clone BC96 validated for use in Flow Cytometry for the detection of CD25. pricing
MABF547 Anti-CD25 Antibody (human), PE-Cy7, clone BC96 This mouse monoclonal antibody Anti-CD25 (human), PE-Cy7 & clone BC96 validated for use in Flow Cytometry for the detection of CD25. pricing
MABF396 Anti-CD25 Antibody (mouse), APC, clone PC61.5 This rat monoclonal antibody Anti-CD25 (mouse), APC & clone PC61.5 validated for use in IP;IHC;Flow Cytometry for the detection of CD25. pricing
MABF548 Anti-CD25 Antibody (mouse), APC, clone PC61.5 This rat monoclonal antibody Anti-CD25 (mouse), APC & clone PC61.5 validated for use in IP;IHC;Flow Cytometry for the detection of CD25. pricing
MABF397 Anti-CD25 Antibody (mouse), PE-Cy7, clone PC61.5 This rat monoclonal antibody Anti-CD25 (mouse), PE-Cy7, clone PC61.5 validated for use in IP, IHC & Flow Cytometry for the detection of CD25. pricing
MABF549 Anti-CD25 Antibody (mouse), PE-Cy7, clone PC61.5 This rat monoclonal antibody Anti-CD25 (mouse), PE-Cy7, clone PC61.5 validated for use in IP, IHC & Flow Cytometry for the detection of CD25. pricing
MABF398 Anti-CD25 Antibody (mouse), PerCP-Cy5.5, clone PC61.5 This rat monoclonal antibody Anti-CD25 (mouse), PerCP-Cy5.5, clone PC61.5 validated for use in IP, IHC & Flow Cytometry for the detection of CD25. pricing
MABF550 Anti-CD25 Antibody (mouse), PerCP-Cy5.5, clone PC61.5 This rat monoclonal antibody Anti-CD25 (mouse), PerCP-Cy5.5, clone PC61.5 validated for use in IP, IHC & Flow Cytometry for the detection of CD25. pricing
05-170 Anti-IL-2 Rα Antibody, clone 7G7/B6 This Anti-IL-2 Rα Antibody, clone 7G7/B6 is validated for use in DB, IC for the detection of IL-2 Rα. pricing
FCMAB190P Milli-Mark™ Anti-CD25-PE Antibody, clone PC61 5.3 Detect CD25 using this Milli-Mark Anti-CD25-PE Antibody, clone PC61 5.3 validated for use in FC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000417 Rosetta Predictions human pricing
NM_013163 Rosetta Predictions rat pricing
NM_008367 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302515 predicted 283
2 SASI_Hs01_00220236 predicted 693
3 SASI_Hs01_00220237 predicted 1023
4 SASI_Hs01_00220238 predicted 387
5 SASI_Hs01_00220239 predicted 777
6 SASI_Hs01_00220240 predicted 347
7 SASI_Hs01_00220241 predicted 1042
8 SASI_Hs01_00220242 predicted 273
9 SASI_Hs01_00220243 predicted 988
10 SASI_Hs02_00302516 predicted 256
11 SASI_Hs01_00220244 predicted 307
12 SASI_Hs01_00220245 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013163 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114319 predicted 292
2 SASI_Rn01_00114320 predicted 528
3 SASI_Rn01_00114321 predicted 589
4 SASI_Rn01_00114322 predicted 260
5 SASI_Rn01_00114323 predicted 663
6 SASI_Rn01_00114324 predicted 774
7 SASI_Rn01_00114325 predicted 914
8 SASI_Rn01_00114326 predicted 282
9 SASI_Rn01_00114327 predicted 346
10 SASI_Rn01_00114328 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095904 predicted 329
2 SASI_Mm01_00095905 predicted 401
3 SASI_Mm01_00095906 predicted 294
4 SASI_Mm01_00095908 predicted 950
5 SASI_Mm01_00095909 predicted 404
6 SASI_Mm01_00095910 predicted 833
7 SASI_Mm01_00095911 predicted 576
8 SASI_Mm01_00095912 predicted 675
9 SASI_Mm01_00095913 predicted 1004
10 SASI_Mm02_00313721 predicted 221
11 SASI_Mm01_00095907 predicted 742
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000417
IL2RA MISSION shRNA Bacterial Glycerol Stock
interleukin 2 receptor, alpha
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000417.1-798s1c1
Sequence:CCGGCCTCGTCACAACAACAGATTTCTCGAGAAATCTGTTGTTGTGACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000417.1-445s1c1
Sequence:CCGGCCTCAACCTGAAGAACAGAAACTCGAGTTTCTGTTCTTCAGGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000417.1-855s1c1
Sequence:CCGGGTCCATATTTACAACAGAGTACTCGAGTACTCTGTTGTAAATATGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000417.1-303s1c1
Sequence:CCGGCTGTGAATGCAAGAGAGGTTTCTCGAGAAACCTCTCTTGCATTCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000417.1-562s1c1
Sequence:CCGGGCCACAGAGAGAATTTATCATCTCGAGATGATAAATTCTCTCTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000417.2-478s21c1
Sequence:CCGGACTCGGAACACAACGAAACAACTCGAGTTGTTTCGTTGTGTTCCGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000417.2-1483s21c1
Sequence:CCGGACCCTATACAACTGGACATTGCTCGAGCAATGTCCAGTTGTATAGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000417
IL2RA MISSION shRNA shRNA Plasmid DNA
interleukin 2 receptor, alpha
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000417.1-798s1c1
Sequence:CCGGCCTCGTCACAACAACAGATTTCTCGAGAAATCTGTTGTTGTGACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000417.1-445s1c1
Sequence:CCGGCCTCAACCTGAAGAACAGAAACTCGAGTTTCTGTTCTTCAGGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000417.1-855s1c1
Sequence:CCGGGTCCATATTTACAACAGAGTACTCGAGTACTCTGTTGTAAATATGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000417.1-303s1c1
Sequence:CCGGCTGTGAATGCAAGAGAGGTTTCTCGAGAAACCTCTCTTGCATTCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000417.1-562s1c1
Sequence:CCGGGCCACAGAGAGAATTTATCATCTCGAGATGATAAATTCTCTCTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000417.2-478s21c1
Sequence:CCGGACTCGGAACACAACGAAACAACTCGAGTTGTTTCGTTGTGTTCCGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000417.2-1483s21c1
Sequence:CCGGACCCTATACAACTGGACATTGCTCGAGCAATGTCCAGTTGTATAGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000417
IL2RA MISSION shRNA Lentiviral Transduction Particles
interleukin 2 receptor, alpha
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000417.1-798s1c1
Sequence:CCGGCCTCGTCACAACAACAGATTTCTCGAGAAATCTGTTGTTGTGACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000417.1-445s1c1
Sequence:CCGGCCTCAACCTGAAGAACAGAAACTCGAGTTTCTGTTCTTCAGGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000417.1-855s1c1
Sequence:CCGGGTCCATATTTACAACAGAGTACTCGAGTACTCTGTTGTAAATATGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000417.1-303s1c1
Sequence:CCGGCTGTGAATGCAAGAGAGGTTTCTCGAGAAACCTCTCTTGCATTCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000417.1-562s1c1
Sequence:CCGGGCCACAGAGAGAATTTATCATCTCGAGATGATAAATTCTCTCTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000417.2-478s21c1
Sequence:CCGGACTCGGAACACAACGAAACAACTCGAGTTGTTTCGTTGTGTTCCGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000417.2-1483s21c1
Sequence:CCGGACCCTATACAACTGGACATTGCTCGAGCAATGTCCAGTTGTATAGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008367
IL2RA MISSION shRNA Bacterial Glycerol Stock
interleukin 2 receptor, alpha
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008367.2-828s1c1
Sequence:CCGGCGGAGACATTTGTGCTCACAACTCGAGTTGTGAGCACAAATGTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008367.2-422s1c1
Sequence:CCGGGCTCAACTTGAACACCAGAAACTCGAGTTTCTGGTGTTCAAGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008367.2-719s1c1
Sequence:CCGGCTGGCTAGTGAGGAATCTCAACTCGAGTTGAGATTCCTCACTAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008367.2-186s1c1
Sequence:CCGGCATTAACCATAGTACCCAGTTCTCGAGAACTGGGTACTATGGTTAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008367.2-589s1c1
Sequence:CCGGCGAGTGTATTCCGGGATACAACTCGAGTTGTATCCCGGAATACACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008367
IL2RA MISSION shRNA shRNA Plasmid DNA
interleukin 2 receptor, alpha
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008367.2-828s1c1
Sequence:CCGGCGGAGACATTTGTGCTCACAACTCGAGTTGTGAGCACAAATGTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008367.2-422s1c1
Sequence:CCGGGCTCAACTTGAACACCAGAAACTCGAGTTTCTGGTGTTCAAGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008367.2-719s1c1
Sequence:CCGGCTGGCTAGTGAGGAATCTCAACTCGAGTTGAGATTCCTCACTAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008367.2-186s1c1
Sequence:CCGGCATTAACCATAGTACCCAGTTCTCGAGAACTGGGTACTATGGTTAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008367.2-589s1c1
Sequence:CCGGCGAGTGTATTCCGGGATACAACTCGAGTTGTATCCCGGAATACACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008367
IL2RA MISSION shRNA Lentiviral Transduction Particles
interleukin 2 receptor, alpha
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008367.2-828s1c1
Sequence:CCGGCGGAGACATTTGTGCTCACAACTCGAGTTGTGAGCACAAATGTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008367.2-422s1c1
Sequence:CCGGGCTCAACTTGAACACCAGAAACTCGAGTTTCTGGTGTTCAAGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008367.2-719s1c1
Sequence:CCGGCTGGCTAGTGAGGAATCTCAACTCGAGTTGAGATTCCTCACTAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008367.2-186s1c1
Sequence:CCGGCATTAACCATAGTACCCAGTTCTCGAGAACTGGGTACTATGGTTAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008367.2-589s1c1
Sequence:CCGGCGAGTGTATTCCGGGATACAACTCGAGTTGTATCCCGGAATACACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)