EMAIL THIS PAGE TO A FRIEND

IL2RB

interleukin 2 receptor, beta

67 Gene Product Result for
Synonyms: CD122 IL15RB P70-75
UniProtKB ID: P14784, B2R765
Gene ID:
Human(3560) Summary: The interleukin 2 receptor, which is involved in T cell-mediated immune responses, is present in 3 forms with respect to ability to bind interleukin 2. The low affinity form is a monomer of the alpha subunit and is not involved in signal transduction. The intermediate affinity form consists of an alpha/beta subunit heterodimer, while the high affinity form consists of an alpha/beta/gamma subunit heterotrimer. Both the intermediate and high affinity forms of the receptor are involved in receptor-mediated endocytosis and transduction of mitogenic signals from interleukin 2. The protein encoded by this gene represents the beta subunit and is a type I membrane protein. [provided by RefSeq, Jul 2008]
Mouse(16185) interleukin 2 receptor, beta chain
Rat(25746) interleukin 2 receptor, beta
domestic guinea pig(100730639) interleukin 2 receptor, beta
naked mole-rat(101726369) interleukin 2 receptor, beta
sheep(101107088) interleukin 2 receptor, beta
Zebrafish(793920) interleukin 2 receptor, beta
dog(403439) interleukin 2 receptor, beta
domestic cat(101092622) interleukin 2 receptor, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501539 Anti-IL-2R β antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, western blot pricing
SAB4501540 Anti-IL-2R β antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB1105025 Anti-IL2RB (451-465) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
HPA062657 Anti-IL2RB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
SAB1410705 Anti-IL2RB antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
I6277 Anti-Interleukin-2 Soluble Receptor β antibody produced in goat affinity isolated antibody, lyophilized powder human
ELISA, neutralization, western blot pricing
SAB4504238 Anti-phospho-IL-2R β (pTyr364) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4504240 Anti-phospho-IL-2R β/CD122 (pTyr364) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4301264 Anti-phospho-IL-2Rβ/CD122 (pTyr364) antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
I5777 Monoclonal Anti-Interleukin-2 Soluble Receptor β antibody produced in mouse clone 27302.1, purified immunoglobulin, lyophilized powder human
ELISA, neutralization, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000878 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000878 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000878 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008368 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008368 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008368 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000878 Rosetta Predictions human pricing
NM_013195 Rosetta Predictions rat pricing
NM_008368 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093919 predicted 1770
2 SASI_Hs01_00093920 predicted 941
3 SASI_Hs01_00093921 predicted 2098
4 SASI_Hs01_00093922 predicted 1296
5 SASI_Hs01_00093923 predicted 220
6 SASI_Hs02_00303416 predicted 1726
7 SASI_Hs01_00093925 predicted 1759
8 SASI_Hs01_00093927 predicted 1727
9 SASI_Hs01_00093928 predicted 1929
10 SASI_Hs02_00303417 predicted 2043
11 SASI_Hs01_00093924 predicted 1197
12 SASI_Hs01_00093926 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013195 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043387 predicted 1687
2 SASI_Rn01_00043388 predicted 1201
3 SASI_Rn02_00261065 predicted 537
4 SASI_Rn01_00043389 predicted 1608
5 SASI_Rn01_00043390 predicted 1696
6 SASI_Rn01_00043392 predicted 1805
7 SASI_Rn02_00261066 predicted 1566
8 SASI_Rn01_00043394 predicted 1670
9 SASI_Rn01_00043395 predicted 1770
10 SASI_Rn01_00043396 predicted 1102
11 SASI_Rn01_00043391 predicted 1797
12 SASI_Rn01_00043393 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008368 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036971 predicted 509
2 SASI_Mm01_00036972 predicted 532
3 SASI_Mm01_00036973 predicted 652
4 SASI_Mm01_00036974 predicted 966
5 SASI_Mm01_00036975 predicted 728
6 SASI_Mm01_00036976 predicted 1194
7 SASI_Mm01_00036977 predicted 193
8 SASI_Mm01_00036978 predicted 580
9 SASI_Mm01_00036979 predicted 1611
10 SASI_Mm01_00036980 predicted 516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000878
IL2RB MISSION shRNA Bacterial Glycerol Stock
interleukin 2 receptor, beta
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000878.2-1565s21c1
Sequence:CCGGAGTCCCAGACCTGGTGGATTTCTCGAGAAATCCACCAGGTCTGGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000878.2-563s21c1
Sequence:CCGGGACCCACAGATGCAACATAAGCTCGAGCTTATGTTGCATCTGTGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000878.2-729s1c1
Sequence:CCGGCCAGACACCCAGTATGAGTTTCTCGAGAAACTCATACTGGGTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000878.2-1214s1c1
Sequence:CCGGCCAGGGTTACTTCTTCTTCCACTCGAGTGGAAGAAGAAGTAACCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000878.2-1734s1c1
Sequence:CCGGGCCTACTTGTCCCTCCAAGAACTCGAGTTCTTGGAGGGACAAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000878.2-899s1c1
Sequence:CCGGCTTCATCATCTTAGTGTACTTCTCGAGAAGTACACTAAGATGATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000878
IL2RB MISSION shRNA shRNA Plasmid DNA
interleukin 2 receptor, beta
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000878.2-1565s21c1
Sequence:CCGGAGTCCCAGACCTGGTGGATTTCTCGAGAAATCCACCAGGTCTGGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000878.2-563s21c1
Sequence:CCGGGACCCACAGATGCAACATAAGCTCGAGCTTATGTTGCATCTGTGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000878.2-729s1c1
Sequence:CCGGCCAGACACCCAGTATGAGTTTCTCGAGAAACTCATACTGGGTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000878.2-1214s1c1
Sequence:CCGGCCAGGGTTACTTCTTCTTCCACTCGAGTGGAAGAAGAAGTAACCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000878.2-1734s1c1
Sequence:CCGGGCCTACTTGTCCCTCCAAGAACTCGAGTTCTTGGAGGGACAAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000878.2-899s1c1
Sequence:CCGGCTTCATCATCTTAGTGTACTTCTCGAGAAGTACACTAAGATGATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000878
IL2RB MISSION shRNA Lentiviral Transduction Particles
interleukin 2 receptor, beta
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000878.2-1565s21c1
Sequence:CCGGAGTCCCAGACCTGGTGGATTTCTCGAGAAATCCACCAGGTCTGGGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000878.2-563s21c1
Sequence:CCGGGACCCACAGATGCAACATAAGCTCGAGCTTATGTTGCATCTGTGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000878.2-729s1c1
Sequence:CCGGCCAGACACCCAGTATGAGTTTCTCGAGAAACTCATACTGGGTGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000878.2-1214s1c1
Sequence:CCGGCCAGGGTTACTTCTTCTTCCACTCGAGTGGAAGAAGAAGTAACCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000878.2-1734s1c1
Sequence:CCGGGCCTACTTGTCCCTCCAAGAACTCGAGTTCTTGGAGGGACAAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000878.2-899s1c1
Sequence:CCGGCTTCATCATCTTAGTGTACTTCTCGAGAAGTACACTAAGATGATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008368
IL2RB MISSION shRNA Bacterial Glycerol Stock
interleukin 2 receptor, beta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008368.3-1701s1c1
Sequence:CCGGCCCAAGATTCAGTCCACCTAACTCGAGTTAGGTGGACTGAATCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008368.3-1673s1c1
Sequence:CCGGGCCTATCTGTCTCTTCAAGAACTCGAGTTCTTGAAGAGACAGATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008368.3-2035s1c1
Sequence:CCGGCCCGAATACAAACATAACCTTCTCGAGAAGGTTATGTTTGTATTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008368.3-700s1c1
Sequence:CCGGGCTGATCCCTAGTACCTCATACTCGAGTATGAGGTACTAGGGATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008368.3-202s1c1
Sequence:CCGGCCATCTTGAATGCTTCTACAACTCGAGTTGTAGAAGCATTCAAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008368
IL2RB MISSION shRNA shRNA Plasmid DNA
interleukin 2 receptor, beta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008368.3-1701s1c1
Sequence:CCGGCCCAAGATTCAGTCCACCTAACTCGAGTTAGGTGGACTGAATCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008368.3-1673s1c1
Sequence:CCGGGCCTATCTGTCTCTTCAAGAACTCGAGTTCTTGAAGAGACAGATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008368.3-2035s1c1
Sequence:CCGGCCCGAATACAAACATAACCTTCTCGAGAAGGTTATGTTTGTATTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008368.3-700s1c1
Sequence:CCGGGCTGATCCCTAGTACCTCATACTCGAGTATGAGGTACTAGGGATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008368.3-202s1c1
Sequence:CCGGCCATCTTGAATGCTTCTACAACTCGAGTTGTAGAAGCATTCAAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008368
IL2RB MISSION shRNA Lentiviral Transduction Particles
interleukin 2 receptor, beta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008368.3-1701s1c1
Sequence:CCGGCCCAAGATTCAGTCCACCTAACTCGAGTTAGGTGGACTGAATCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008368.3-1673s1c1
Sequence:CCGGGCCTATCTGTCTCTTCAAGAACTCGAGTTCTTGAAGAGACAGATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008368.3-2035s1c1
Sequence:CCGGCCCGAATACAAACATAACCTTCTCGAGAAGGTTATGTTTGTATTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008368.3-700s1c1
Sequence:CCGGGCTGATCCCTAGTACCTCATACTCGAGTATGAGGTACTAGGGATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008368.3-202s1c1
Sequence:CCGGCCATCTTGAATGCTTCTACAACTCGAGTTGTAGAAGCATTCAAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)