EMAIL THIS PAGE TO A FRIEND

IL2RG

interleukin 2 receptor, gamma

68 Gene Product Result for
Synonyms: CD132 CIDX IL-2RG IMD4 P64 SCIDX SCIDX1
UniProtKB ID: P31785, Q5FC12
Gene ID:
Human(3561) Summary: The protein encoded by this gene is an important signaling component of many interleukin receptors, including those of interleukin -2, -4, -7 and -21, and is thus referred to as the common gamma chain. Mutations in this gene cause X-linked severe combined immunodeficiency (XSCID), as well as X-linked combined immunodeficiency (XCID), a less severe immunodeficiency disorder. [provided by RefSeq, Mar 2010]
Mouse(16186) interleukin 2 receptor, gamma chain
Rat(140924) interleukin 2 receptor, gamma
chicken(395199) interleukin 2 receptor, gamma (severe combined immunodeficiency)
dog(403851) interleukin 2 receptor, gamma
cow(281862) interleukin 2 receptor, gamma
domestic cat(101090239) interleukin 2 receptor, gamma
sheep(101103538) interleukin 2 receptor, gamma
domestic guinea pig(100713379) interleukin 2 receptor, gamma
naked mole-rat(101715243) interleukin 2 receptor, gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000206 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000206 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000206 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013563 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013563 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013563 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000206 Rosetta Predictions human pricing
NM_080889 Rosetta Predictions rat pricing
NM_013563 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044754 predicted 481
2 SASI_Hs01_00044755 predicted 503
3 SASI_Hs01_00044756 predicted 887
4 SASI_Hs01_00044757 predicted 289
5 SASI_Hs01_00044758 predicted 780
6 SASI_Hs02_00302083 predicted 1092
7 SASI_Hs01_00044760 predicted 792
8 SASI_Hs02_00302084 predicted 271
9 SASI_Hs01_00044761 predicted 558
10 SASI_Hs01_00044762 predicted 620
11 SASI_Hs01_00044759 predicted 1102
12 SASI_Hs01_00044763 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080889 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096533 predicted 836
2 SASI_Rn01_00096534 predicted 534
3 SASI_Rn01_00096535 predicted 598
4 SASI_Rn01_00096536 predicted 277
5 SASI_Rn01_00096537 predicted 383
6 SASI_Rn01_00096538 predicted 886
7 SASI_Rn01_00096539 predicted 724
8 SASI_Rn01_00096540 predicted 195
9 SASI_Rn01_00096541 predicted 265
10 SASI_Rn01_00096542 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013563 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028731 predicted 913
2 SASI_Mm02_00322302 predicted 296
3 SASI_Mm01_00028732 predicted 564
4 SASI_Mm01_00028733 predicted 625
5 SASI_Mm01_00028734 predicted 1173
6 SASI_Mm01_00028735 predicted 792
7 SASI_Mm02_00322303 predicted 1204
8 SASI_Mm01_00028737 predicted 277
9 SASI_Mm01_00028738 predicted 1120
10 SASI_Mm01_00028739 predicted 1004
11 SASI_Mm01_00028736 predicted 1205
12 SASI_Mm01_00028740 predicted 1148
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000206
IL2RG MISSION shRNA Bacterial Glycerol Stock
interleukin 2 receptor, gamma
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000206.1-521s1c1
Sequence:CCGGGCTAGAACTGAACTGGAACAACTCGAGTTGTTCCAGTTCAGTTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000206.1-605s1c1
Sequence:CCGGGACTGAACAATCAGTGGATTACTCGAGTAATCCACTGATTGTTCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000206.1-712s1c1
Sequence:CCGGGTGCTCAGCATTGGAGTGAATCTCGAGATTCACTCCAATGCTGAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000206.1-262s1c1
Sequence:CCGGCCAACCTCACTCTGCATTATTCTCGAGAATAATGCAGAGTGAGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000206.1-87s1c1
Sequence:CCGGACGACAATTCTGACGCCCAATCTCGAGATTGGGCGTCAGAATTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000206.1-814s21c1
Sequence:CCGGTTGGCTCCATGGGATTGATTACTCGAGTAATCAATCCCATGGAGCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000206.1-1164s21c1
Sequence:CCGGCCCTAAGTGGTACTAACTTTCCTCGAGGAAAGTTAGTACCACTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000206.1-677s21c1
Sequence:CCGGTCGTGTTCGGAGCCGCTTTAACTCGAGTTAAAGCGGCTCCGAACACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000206
IL2RG MISSION shRNA shRNA Plasmid DNA
interleukin 2 receptor, gamma
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000206.1-521s1c1
Sequence:CCGGGCTAGAACTGAACTGGAACAACTCGAGTTGTTCCAGTTCAGTTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000206.1-605s1c1
Sequence:CCGGGACTGAACAATCAGTGGATTACTCGAGTAATCCACTGATTGTTCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000206.1-712s1c1
Sequence:CCGGGTGCTCAGCATTGGAGTGAATCTCGAGATTCACTCCAATGCTGAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000206.1-262s1c1
Sequence:CCGGCCAACCTCACTCTGCATTATTCTCGAGAATAATGCAGAGTGAGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000206.1-87s1c1
Sequence:CCGGACGACAATTCTGACGCCCAATCTCGAGATTGGGCGTCAGAATTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000206.1-814s21c1
Sequence:CCGGTTGGCTCCATGGGATTGATTACTCGAGTAATCAATCCCATGGAGCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000206.1-1164s21c1
Sequence:CCGGCCCTAAGTGGTACTAACTTTCCTCGAGGAAAGTTAGTACCACTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000206.1-677s21c1
Sequence:CCGGTCGTGTTCGGAGCCGCTTTAACTCGAGTTAAAGCGGCTCCGAACACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000206
IL2RG MISSION shRNA Lentiviral Transduction Particles
interleukin 2 receptor, gamma
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000206.1-521s1c1
Sequence:CCGGGCTAGAACTGAACTGGAACAACTCGAGTTGTTCCAGTTCAGTTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000206.1-605s1c1
Sequence:CCGGGACTGAACAATCAGTGGATTACTCGAGTAATCCACTGATTGTTCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000206.1-712s1c1
Sequence:CCGGGTGCTCAGCATTGGAGTGAATCTCGAGATTCACTCCAATGCTGAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000206.1-262s1c1
Sequence:CCGGCCAACCTCACTCTGCATTATTCTCGAGAATAATGCAGAGTGAGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000206.1-87s1c1
Sequence:CCGGACGACAATTCTGACGCCCAATCTCGAGATTGGGCGTCAGAATTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000206.1-814s21c1
Sequence:CCGGTTGGCTCCATGGGATTGATTACTCGAGTAATCAATCCCATGGAGCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000206.1-1164s21c1
Sequence:CCGGCCCTAAGTGGTACTAACTTTCCTCGAGGAAAGTTAGTACCACTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000206.1-677s21c1
Sequence:CCGGTCGTGTTCGGAGCCGCTTTAACTCGAGTTAAAGCGGCTCCGAACACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013563
IL2RG MISSION shRNA Bacterial Glycerol Stock
interleukin 2 receptor, gamma
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013563.2-864s1c1
Sequence:CCGGCCCTGATCTTTGTGTACTGTTCTCGAGAACAGTACACAAAGATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013563.2-567s1c1
Sequence:CCGGGACATATTAAAGAACGCTGTTCTCGAGAACAGCGTTCTTTAATATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013563.2-128s1c1
Sequence:CCGGAGTGCGAATGAAGACATCAAACTCGAGTTTGATGTCTTCATTCGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013563.2-334s1c1
Sequence:CCGGCCAGGAGTGCAGTCACTATTTCTCGAGAAATAGTGACTGCACTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013563.2-461s1c1
Sequence:CCGGGCTGTACAGAAGCTAAACCTACTCGAGTAGGTTTAGCTTCTGTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013563
IL2RG MISSION shRNA shRNA Plasmid DNA
interleukin 2 receptor, gamma
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013563.2-864s1c1
Sequence:CCGGCCCTGATCTTTGTGTACTGTTCTCGAGAACAGTACACAAAGATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013563.2-567s1c1
Sequence:CCGGGACATATTAAAGAACGCTGTTCTCGAGAACAGCGTTCTTTAATATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013563.2-128s1c1
Sequence:CCGGAGTGCGAATGAAGACATCAAACTCGAGTTTGATGTCTTCATTCGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013563.2-334s1c1
Sequence:CCGGCCAGGAGTGCAGTCACTATTTCTCGAGAAATAGTGACTGCACTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013563.2-461s1c1
Sequence:CCGGGCTGTACAGAAGCTAAACCTACTCGAGTAGGTTTAGCTTCTGTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013563
IL2RG MISSION shRNA Lentiviral Transduction Particles
interleukin 2 receptor, gamma
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013563.2-864s1c1
Sequence:CCGGCCCTGATCTTTGTGTACTGTTCTCGAGAACAGTACACAAAGATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013563.2-567s1c1
Sequence:CCGGGACATATTAAAGAACGCTGTTCTCGAGAACAGCGTTCTTTAATATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013563.2-128s1c1
Sequence:CCGGAGTGCGAATGAAGACATCAAACTCGAGTTTGATGTCTTCATTCGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013563.2-334s1c1
Sequence:CCGGCCAGGAGTGCAGTCACTATTTCTCGAGAAATAGTGACTGCACTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013563.2-461s1c1
Sequence:CCGGGCTGTACAGAAGCTAAACCTACTCGAGTAGGTTTAGCTTCTGTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)