EMAIL THIS PAGE TO A FRIEND

IL31

interleukin 31

48 Gene Product Result for
Synonyms: IL-31
UniProtKB ID: Q6EBC2, A2RUQ1
Gene ID:
Human(386653) Summary: IL31, which is made principally by activated Th2-type T cells, interacts with a heterodimeric receptor consisting of IL31RA (MIM 609510) and OSMR (MIM 601743) that is constitutively expressed on epithelial cells and keratinocytes. IL31 may be involved in the promotion of allergic skin disorders and in regulating other allergic diseases, such as asthma (Dillon et al., 2004 [PubMed 15184896]
Mouse(76399) interleukin 31
Rat(690028) interleukin 31
naked mole-rat(101697067) interleukin 31
dog(100302725) interleukin 31
cow(101903065) interleukin 31
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001014336 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001014336 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001014336 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029594 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029594 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029594 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU069971 MISSION® esiRNA esiRNA targeting mouse Il31 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014336 Rosetta Predictions human pricing
XM_132344 Rosetta Predictions mouse pricing
XM_915437 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154471 predicted 308
2 SASI_Hs01_00154472 predicted 512
3 SASI_Hs01_00154473 predicted 515
4 SASI_Hs01_00154474 predicted 599
5 SASI_Hs01_00154475 predicted 547
6 SASI_Hs01_00154476 predicted 322
7 SASI_Hs01_00154477 predicted 432
8 SASI_Hs01_00154478 predicted 291
9 SASI_Hs01_00154479 predicted 501
10 SASI_Hs01_00154480 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132344 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208824 predicted 272
2 SASI_Mm01_00208826 predicted 290
3 SASI_Mm02_00424462 predicted 294
4 SASI_Mm01_00208827 predicted 273
5 SASI_Mm01_00208828 predicted 277
6 SASI_Mm01_00208830 predicted 236
7 SASI_Mm01_00208831 predicted 240
8 SASI_Mm02_00424463 predicted 292
9 SASI_Mm01_00208832 predicted 278
10 SASI_Mm01_00208833 predicted 249
11 SASI_Mm01_00208825 predicted 326
12 SASI_Mm01_00208829 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915437 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439437 predicted 275
2 SASI_Mm02_00439438 predicted 296
3 SASI_Mm02_00439439 predicted 298
4 SASI_Mm02_00439440 predicted 274
5 SASI_Mm02_00439441 predicted 277
6 SASI_Mm02_00439442 predicted 237
7 SASI_Mm02_00439443 predicted 240
8 SASI_Mm02_00439444 predicted 292
9 SASI_Mm02_00439445 predicted 277
10 SASI_Mm02_00439446 predicted 249
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001014336
IL31 MISSION shRNA Bacterial Glycerol Stock
interleukin 31
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014336.1-301s1c1
Sequence:CCGGCTCAAGACAATCAGACAGCTACTCGAGTAGCTGTCTGATTGTCTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001014336.1-672s1c1
Sequence:CCGGGCTGAGATGTGAATTTGTGAACTCGAGTTCACAAATTCACATCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014336.1-417s1c1
Sequence:CCGGCCATGAATGTAAACGCTTCATCTCGAGATGAAGCGTTTACATTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014336.1-438s1c1
Sequence:CCGGCCTGACTATTTCTCAACAGTTCTCGAGAACTGTTGAGAAATAGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014336.1-295s1c1
Sequence:CCGGGCATATCTCAAGACAATCAGACTCGAGTCTGATTGTCTTGAGATATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014336.1-127s1c1
Sequence:CCGGCCAAGTGATGATGTACAGAAACTCGAGTTTCTGTACATCATCACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001014336
IL31 MISSION shRNA shRNA Plasmid DNA
interleukin 31
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014336.1-301s1c1
Sequence:CCGGCTCAAGACAATCAGACAGCTACTCGAGTAGCTGTCTGATTGTCTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001014336.1-672s1c1
Sequence:CCGGGCTGAGATGTGAATTTGTGAACTCGAGTTCACAAATTCACATCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014336.1-417s1c1
Sequence:CCGGCCATGAATGTAAACGCTTCATCTCGAGATGAAGCGTTTACATTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014336.1-438s1c1
Sequence:CCGGCCTGACTATTTCTCAACAGTTCTCGAGAACTGTTGAGAAATAGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014336.1-295s1c1
Sequence:CCGGGCATATCTCAAGACAATCAGACTCGAGTCTGATTGTCTTGAGATATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014336.1-127s1c1
Sequence:CCGGCCAAGTGATGATGTACAGAAACTCGAGTTTCTGTACATCATCACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001014336
IL31 MISSION shRNA Lentiviral Transduction Particles
interleukin 31
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014336.1-301s1c1
Sequence:CCGGCTCAAGACAATCAGACAGCTACTCGAGTAGCTGTCTGATTGTCTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001014336.1-672s1c1
Sequence:CCGGGCTGAGATGTGAATTTGTGAACTCGAGTTCACAAATTCACATCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014336.1-417s1c1
Sequence:CCGGCCATGAATGTAAACGCTTCATCTCGAGATGAAGCGTTTACATTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014336.1-438s1c1
Sequence:CCGGCCTGACTATTTCTCAACAGTTCTCGAGAACTGTTGAGAAATAGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014336.1-295s1c1
Sequence:CCGGGCATATCTCAAGACAATCAGACTCGAGTCTGATTGTCTTGAGATATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014336.1-127s1c1
Sequence:CCGGCCAAGTGATGATGTACAGAAACTCGAGTTTCTGTACATCATCACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029594
IL31 MISSION shRNA Bacterial Glycerol Stock
interleukin 31
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029594.1-601s21c1
Sequence:CCGGGCTTGCAACCCAGGACTTAACCTCGAGGTTAAGTCCTGGGTTGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029594.1-257s21c1
Sequence:CCGGTCAATACAGCTGCCGTGTTTCCTCGAGGAAACACGGCAGCTGTATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029594.1-300s21c1
Sequence:CCGGCCAACATCTCGGTCATCATAGCTCGAGCTATGATGACCGAGATGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029594.1-374s21c1
Sequence:CCGGGTGATAAGATGGCTAACAAACCTCGAGGTTTGTTAGCCATCTTATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029594.1-190s21c1
Sequence:CCGGACAAGAGTCTCAGGATCTTTACTCGAGTAAAGATCCTGAGACTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029594
IL31 MISSION shRNA shRNA Plasmid DNA
interleukin 31
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029594.1-601s21c1
Sequence:CCGGGCTTGCAACCCAGGACTTAACCTCGAGGTTAAGTCCTGGGTTGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029594.1-257s21c1
Sequence:CCGGTCAATACAGCTGCCGTGTTTCCTCGAGGAAACACGGCAGCTGTATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029594.1-300s21c1
Sequence:CCGGCCAACATCTCGGTCATCATAGCTCGAGCTATGATGACCGAGATGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029594.1-374s21c1
Sequence:CCGGGTGATAAGATGGCTAACAAACCTCGAGGTTTGTTAGCCATCTTATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029594.1-190s21c1
Sequence:CCGGACAAGAGTCTCAGGATCTTTACTCGAGTAAAGATCCTGAGACTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029594
IL31 MISSION shRNA Lentiviral Transduction Particles
interleukin 31
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029594.1-601s21c1
Sequence:CCGGGCTTGCAACCCAGGACTTAACCTCGAGGTTAAGTCCTGGGTTGCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029594.1-257s21c1
Sequence:CCGGTCAATACAGCTGCCGTGTTTCCTCGAGGAAACACGGCAGCTGTATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029594.1-300s21c1
Sequence:CCGGCCAACATCTCGGTCATCATAGCTCGAGCTATGATGACCGAGATGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029594.1-374s21c1
Sequence:CCGGGTGATAAGATGGCTAACAAACCTCGAGGTTTGTTAGCCATCTTATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029594.1-190s21c1
Sequence:CCGGACAAGAGTCTCAGGATCTTTACTCGAGTAAAGATCCTGAGACTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)