EMAIL THIS PAGE TO A FRIEND

IL31RA

interleukin 31 receptor A

47 Gene Product Result for
Synonyms: CRL CRL3 GLM-R GLMR GPL IL-31RA PLCA2 PRO21384 hGLM-R
Gene ID:
Human(133396) Summary: The protein encoded by this gene belongs to the type I cytokine receptor family. This receptor, with homology to gp130, is expressed on monocytes, and is involved in IL-31 signaling via activation of STAT-3 and STAT-5. It functions either as a monomer, or as part of a receptor complex with oncostatin M receptor (OSMR). Several alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jun 2011]
Mouse(218624) interleukin 31 receptor A
Rat(688622) interleukin 31 receptor A
chicken(427140) interleukin 31 receptor A
Horse(100062017) interleukin 31 receptor A
cow(522636) interleukin 31 receptor A
domestic cat(101095878) interleukin 31 receptor A
dog(487212) interleukin 31 receptor A
domestic guinea pig(100724300) interleukin 31 receptor A
naked mole-rat(101704202) interleukin 31 receptor A
sheep(101113274) interleukin 31 receptor A
Domestic Rabbit(100347492) interleukin 31 receptor A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139017 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139017 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139017 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139299 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139299 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139299 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081121 MISSION® esiRNA esiRNA human IL31RA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139017 Rosetta Predictions human pricing
NM_139299 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139017 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125534 predicted 497
2 SASI_Hs02_00364059 predicted 572
3 SASI_Hs01_00125537 predicted 948
4 SASI_Hs01_00125538 predicted 1455
5 SASI_Hs01_00125539 predicted 637
6 SASI_Hs01_00125540 predicted 1714
7 SASI_Hs01_00125541 predicted 1227
8 SASI_Hs01_00125542 predicted 1715
9 SASI_Hs01_00125543 predicted 867
10 SASI_Hs02_00364060 predicted 1405
11 SASI_Hs01_00125535 predicted 957
12 SASI_Hs01_00125536 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139299 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185209 predicted 783
2 SASI_Mm02_00339986 predicted 724
3 SASI_Mm01_00185210 predicted 1336
4 SASI_Mm01_00185211 predicted 600
5 SASI_Mm01_00185212 predicted 483
6 SASI_Mm01_00185213 predicted 2001
7 SASI_Mm01_00185214 predicted 737
8 SASI_Mm01_00185215 predicted 1622
9 SASI_Mm01_00185216 predicted 479
10 SASI_Mm01_00185217 predicted 2589
11 SASI_Mm01_00185218 predicted 1940
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139017
IL31RA MISSION shRNA Bacterial Glycerol Stock
interleukin 31 receptor A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139017.4-244s21c1
Sequence:CCGGTTTCCTGTGTCTACTACTATACTCGAGTATAGTAGTAGACACAGGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139017.4-566s21c1
Sequence:CCGGCATCAAACGAATGATTCAAATCTCGAGATTTGAATCATTCGTTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139017.3-565s1c1
Sequence:CCGGCGCCTGTTTCATCTGATTTAACTCGAGTTAAATCAGATGAAACAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139017.3-1565s1c1
Sequence:CCGGCCTGAAACGAAAGACCTCTTACTCGAGTAAGAGGTCTTTCGTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139017.3-1633s1c1
Sequence:CCGGCCAGCATAAATTTCAAGACATCTCGAGATGTCTTGAAATTTATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139017.3-372s1c1
Sequence:CCGGCCAAGAATAACGATCCCAGATCTCGAGATCTGGGATCGTTATTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139017.3-268s1c1
Sequence:CCGGCCCAGTACACAGTTAAGAGAACTCGAGTTCTCTTAACTGTGTACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139017
IL31RA MISSION shRNA shRNA Plasmid DNA
interleukin 31 receptor A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139017.4-244s21c1
Sequence:CCGGTTTCCTGTGTCTACTACTATACTCGAGTATAGTAGTAGACACAGGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139017.4-566s21c1
Sequence:CCGGCATCAAACGAATGATTCAAATCTCGAGATTTGAATCATTCGTTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139017.3-565s1c1
Sequence:CCGGCGCCTGTTTCATCTGATTTAACTCGAGTTAAATCAGATGAAACAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139017.3-1565s1c1
Sequence:CCGGCCTGAAACGAAAGACCTCTTACTCGAGTAAGAGGTCTTTCGTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139017.3-1633s1c1
Sequence:CCGGCCAGCATAAATTTCAAGACATCTCGAGATGTCTTGAAATTTATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139017.3-372s1c1
Sequence:CCGGCCAAGAATAACGATCCCAGATCTCGAGATCTGGGATCGTTATTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139017.3-268s1c1
Sequence:CCGGCCCAGTACACAGTTAAGAGAACTCGAGTTCTCTTAACTGTGTACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139017
IL31RA MISSION shRNA Lentiviral Transduction Particles
interleukin 31 receptor A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139017.4-244s21c1
Sequence:CCGGTTTCCTGTGTCTACTACTATACTCGAGTATAGTAGTAGACACAGGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139017.4-566s21c1
Sequence:CCGGCATCAAACGAATGATTCAAATCTCGAGATTTGAATCATTCGTTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139017.3-565s1c1
Sequence:CCGGCGCCTGTTTCATCTGATTTAACTCGAGTTAAATCAGATGAAACAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139017.3-1565s1c1
Sequence:CCGGCCTGAAACGAAAGACCTCTTACTCGAGTAAGAGGTCTTTCGTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139017.3-1633s1c1
Sequence:CCGGCCAGCATAAATTTCAAGACATCTCGAGATGTCTTGAAATTTATGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139017.3-372s1c1
Sequence:CCGGCCAAGAATAACGATCCCAGATCTCGAGATCTGGGATCGTTATTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139017.3-268s1c1
Sequence:CCGGCCCAGTACACAGTTAAGAGAACTCGAGTTCTCTTAACTGTGTACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139299
IL31RA MISSION shRNA Bacterial Glycerol Stock
interleukin 31 receptor A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139299.1-2719s1c1
Sequence:CCGGCCAGGAAGAATGGAGTCCTTTCTCGAGAAAGGACTCCATTCTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139299.1-1606s1c1
Sequence:CCGGCCGTATTCAATCCAAGCTTATCTCGAGATAAGCTTGGATTGAATACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139299.1-2193s1c1
Sequence:CCGGGCTGGTAGTGAACTTTGAGAACTCGAGTTCTCAAAGTTCACTACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139299.1-1605s1c1
Sequence:CCGGGCCGTATTCAATCCAAGCTTACTCGAGTAAGCTTGGATTGAATACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139299.1-976s1c1
Sequence:CCGGGCTCTACGATTCAGGTTCAATCTCGAGATTGAACCTGAATCGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139299
IL31RA MISSION shRNA shRNA Plasmid DNA
interleukin 31 receptor A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139299.1-2719s1c1
Sequence:CCGGCCAGGAAGAATGGAGTCCTTTCTCGAGAAAGGACTCCATTCTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139299.1-1606s1c1
Sequence:CCGGCCGTATTCAATCCAAGCTTATCTCGAGATAAGCTTGGATTGAATACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139299.1-2193s1c1
Sequence:CCGGGCTGGTAGTGAACTTTGAGAACTCGAGTTCTCAAAGTTCACTACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139299.1-1605s1c1
Sequence:CCGGGCCGTATTCAATCCAAGCTTACTCGAGTAAGCTTGGATTGAATACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139299.1-976s1c1
Sequence:CCGGGCTCTACGATTCAGGTTCAATCTCGAGATTGAACCTGAATCGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139299
IL31RA MISSION shRNA Lentiviral Transduction Particles
interleukin 31 receptor A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139299.1-2719s1c1
Sequence:CCGGCCAGGAAGAATGGAGTCCTTTCTCGAGAAAGGACTCCATTCTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139299.1-1606s1c1
Sequence:CCGGCCGTATTCAATCCAAGCTTATCTCGAGATAAGCTTGGATTGAATACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139299.1-2193s1c1
Sequence:CCGGGCTGGTAGTGAACTTTGAGAACTCGAGTTCTCAAAGTTCACTACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139299.1-1605s1c1
Sequence:CCGGGCCGTATTCAATCCAAGCTTACTCGAGTAAGCTTGGATTGAATACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139299.1-976s1c1
Sequence:CCGGGCTCTACGATTCAGGTTCAATCTCGAGATTGAACCTGAATCGTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)