EMAIL THIS PAGE TO A FRIEND

IL32

interleukin 32

100 Gene Product Result for
Synonyms: IL-32alpha IL-32beta IL-32delta IL-32gamma NK4 TAIF TAIFa TAIFb TAIFc TAIFd
Gene ID:
Human(9235) Summary: This gene encodes a member of the cytokine family. The protein contains a tyrosine sulfation site, 3 potential N-myristoylation sites, multiple putative phosphorylation sites, and an RGD cell-attachment sequence. Expression of this protein is increased after the activation of T-cells by mitogens or the activation of NK cells by IL-2. This protein induces the production of TNFalpha from macrophage cells. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
cow(505800) interleukin 32
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
SRP4189 IL-32 alpha human recombinant, expressed in E. coli, ≥97% (SDS-PAGE) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004221 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004221 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004221 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088451 MISSION® esiRNA esiRNA human IL32 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012631 Rosetta Predictions human pricing
NM_001012632 Rosetta Predictions human pricing
NM_001012633 Rosetta Predictions human pricing
NM_001012634 Rosetta Predictions human pricing
NM_001012635 Rosetta Predictions human pricing
NM_001012636 Rosetta Predictions human pricing
NM_001012718 Rosetta Predictions human pricing
NM_004221 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077338 predicted 479
2 SASI_Hs01_00077339 predicted 590
3 SASI_Hs01_00077340 predicted 475
4 SASI_Hs01_00077341 predicted 508
5 SASI_Hs01_00077343 predicted 709
6 SASI_Hs01_00077344 predicted 538
7 SASI_Hs01_00077346 predicted 449
8 SASI_Hs01_00077347 predicted 507
9 SASI_Hs02_00306196 predicted 734
10 SASI_Hs02_00306197 predicted 476
11 SASI_Hs01_00077342 predicted 458
12 SASI_Hs01_00077345 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220962 predicted 471
2 SASI_Hs01_00220963 predicted 506
3 SASI_Hs01_00220965 predicted 500
4 SASI_Hs01_00220967 predicted 500
5 SASI_Hs01_00220968 predicted 474
6 SASI_Hs01_00220969 predicted 530
7 SASI_Hs01_00220971 predicted 529
8 SASI_Hs01_00220964 predicted 481
9 SASI_Hs01_00220966 predicted 503
10 SASI_Hs01_00220970 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194973 predicted 373
2 SASI_Hs01_00194974 predicted 408
3 SASI_Hs01_00194975 predicted 252
4 SASI_Hs01_00194976 predicted 438
5 SASI_Hs01_00194977 predicted 254
6 SASI_Hs01_00194978 predicted 372
7 SASI_Hs01_00194979 predicted 217
8 SASI_Hs01_00194980 predicted 480
9 SASI_Hs01_00194981 predicted 308
10 SASI_Hs01_00194982 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055632 predicted 417
2 SASI_Hs01_00055633 predicted 442
3 SASI_Hs01_00055635 predicted 439
4 SASI_Hs01_00055637 predicted 438
5 SASI_Hs01_00055638 predicted 410
6 SASI_Hs01_00055639 predicted 473
7 SASI_Hs01_00055641 predicted 465
8 SASI_Hs01_00055634 predicted 421
9 SASI_Hs01_00055636 predicted 441
10 SASI_Hs01_00055640 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227669 predicted 407
2 SASI_Hs01_00227670 predicted 445
3 SASI_Hs01_00227672 predicted 438
4 SASI_Hs01_00227674 predicted 429
5 SASI_Hs01_00227675 predicted 409
6 SASI_Hs01_00227676 predicted 463
7 SASI_Hs01_00227678 predicted 459
8 SASI_Hs01_00227671 predicted 411
9 SASI_Hs01_00227673 predicted 440
10 SASI_Hs01_00227677 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151055 predicted 396
2 SASI_Hs01_00151056 predicted 431
3 SASI_Hs01_00151058 predicted 420
4 SASI_Hs01_00151060 predicted 415
5 SASI_Hs01_00151061 predicted 395
6 SASI_Hs01_00151062 predicted 456
7 SASI_Hs01_00151064 predicted 450
8 SASI_Hs01_00151057 predicted 396
9 SASI_Hs01_00151059 predicted 423
10 SASI_Hs01_00151063 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013784 predicted 410
2 SASI_Hs01_00013785 predicted 523
3 SASI_Hs01_00013786 predicted 412
4 SASI_Hs01_00013787 predicted 448
5 SASI_Hs01_00013789 predicted 646
6 SASI_Hs01_00013790 predicted 476
7 SASI_Hs01_00013792 predicted 380
8 SASI_Hs01_00013793 predicted 447
9 SASI_Hs02_00306223 predicted 669
10 SASI_Hs02_00306224 predicted 411
11 SASI_Hs01_00013788 predicted 394
12 SASI_Hs01_00013791 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169985 predicted 414
2 SASI_Hs01_00169986 predicted 518
3 SASI_Hs01_00169987 predicted 408
4 SASI_Hs01_00169988 predicted 437
5 SASI_Hs01_00169990 predicted 641
6 SASI_Hs01_00169991 predicted 471
7 SASI_Hs01_00169993 predicted 380
8 SASI_Hs01_00169994 predicted 438
9 SASI_Hs02_00337134 predicted 667
10 SASI_Hs02_00337135 predicted 415
11 SASI_Hs01_00169989 predicted 390
12 SASI_Hs01_00169992 predicted 642
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004221
IL32 MISSION shRNA Bacterial Glycerol Stock
interleukin 32
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004221.3-772s1c2
Sequence:CCGGGCAGGCCCTCTGGAAACAGTTCTCGAGAACTGTTTCCAGAGGGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004221.3-772s1c1
Sequence:CCGGGCAGGCCCTCTGGAAACAGTTCTCGAGAACTGTTTCCAGAGGGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004221.3-261s1c1
Sequence:CCGGGAATGGTAATGCTCCTCCCTACTCGAGTAGGGAGGAGCATTACCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004221.3-820s1c1
Sequence:CCGGGCTCTTCATGTCCTCTTTCCACTCGAGTGGAAAGAGGACATGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004221.3-244s1c1
Sequence:CCGGGAAGAAGCTGAAGGCCCGAATCTCGAGATTCGGGCCTTCAGCTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004221.3-512s1c1
Sequence:CCGGCTGGAGACAGTGGCGGCTTATCTCGAGATAAGCCGCCACTGTCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004221.4-915s21c1
Sequence:CCGGTGTCGCCCTGGCATCTTAATACTCGAGTATTAAGATGCCAGGGCGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004221.4-412s21c1
Sequence:CCGGAGAGCTCACTCCTCTACTTGACTCGAGTCAAGTAGAGGAGTGAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004221.4-343s21c1
Sequence:CCGGAGAGCTGGAGGACGACTTCAACTCGAGTTGAAGTCGTCCTCCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004221
IL32 MISSION shRNA shRNA Plasmid DNA
interleukin 32
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004221.3-772s1c2
Sequence:CCGGGCAGGCCCTCTGGAAACAGTTCTCGAGAACTGTTTCCAGAGGGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004221.3-772s1c1
Sequence:CCGGGCAGGCCCTCTGGAAACAGTTCTCGAGAACTGTTTCCAGAGGGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004221.3-261s1c1
Sequence:CCGGGAATGGTAATGCTCCTCCCTACTCGAGTAGGGAGGAGCATTACCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004221.3-820s1c1
Sequence:CCGGGCTCTTCATGTCCTCTTTCCACTCGAGTGGAAAGAGGACATGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004221.3-244s1c1
Sequence:CCGGGAAGAAGCTGAAGGCCCGAATCTCGAGATTCGGGCCTTCAGCTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004221.3-512s1c1
Sequence:CCGGCTGGAGACAGTGGCGGCTTATCTCGAGATAAGCCGCCACTGTCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004221.4-915s21c1
Sequence:CCGGTGTCGCCCTGGCATCTTAATACTCGAGTATTAAGATGCCAGGGCGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004221.4-412s21c1
Sequence:CCGGAGAGCTCACTCCTCTACTTGACTCGAGTCAAGTAGAGGAGTGAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004221.4-343s21c1
Sequence:CCGGAGAGCTGGAGGACGACTTCAACTCGAGTTGAAGTCGTCCTCCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004221
IL32 MISSION shRNA Lentiviral Transduction Particles
interleukin 32
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004221.3-772s1c2
Sequence:CCGGGCAGGCCCTCTGGAAACAGTTCTCGAGAACTGTTTCCAGAGGGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004221.3-772s1c1
Sequence:CCGGGCAGGCCCTCTGGAAACAGTTCTCGAGAACTGTTTCCAGAGGGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004221.3-261s1c1
Sequence:CCGGGAATGGTAATGCTCCTCCCTACTCGAGTAGGGAGGAGCATTACCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004221.3-820s1c1
Sequence:CCGGGCTCTTCATGTCCTCTTTCCACTCGAGTGGAAAGAGGACATGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004221.3-244s1c1
Sequence:CCGGGAAGAAGCTGAAGGCCCGAATCTCGAGATTCGGGCCTTCAGCTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004221.3-512s1c1
Sequence:CCGGCTGGAGACAGTGGCGGCTTATCTCGAGATAAGCCGCCACTGTCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004221.4-915s21c1
Sequence:CCGGTGTCGCCCTGGCATCTTAATACTCGAGTATTAAGATGCCAGGGCGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004221.4-412s21c1
Sequence:CCGGAGAGCTCACTCCTCTACTTGACTCGAGTCAAGTAGAGGAGTGAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004221.4-343s21c1
Sequence:CCGGAGAGCTGGAGGACGACTTCAACTCGAGTTGAAGTCGTCCTCCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)