EMAIL THIS PAGE TO A FRIEND

IL33

interleukin 33

139 Gene Product Result for
Synonyms: C9orf26 DVS27 IL1F11 NF-HEV NFEHEV RP11-575C20.2
UniProtKB ID: O95760, B4DJ35, B4E1Q9, D3DRI5, E7EAX4, Q2YEJ5
Gene ID:
Human(90865) Summary: IL33 (MIM 608678) is a member of the IL1 (see MIM 147760) family that potently drives production of T helper-2 (Th2)-associated cytokines (e.g., IL4; MIM 147780). IL33 is a ligand for IL33R (IL1RL1; MIM 601203), an IL1 family receptor that is selectively expressed on Th2 cells and mast cells (summary by Yagami et al., 2010 [PubMed 20926795]
Mouse(77125) interleukin 33
Rat(361749) interleukin 33
dog(403810) interleukin 33
cow(507054) interleukin 33
domestic cat(101093403) interleukin 33
sheep(101116705) interleukin 33
naked mole-rat(101723403) interleukin 33
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133775 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133775 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133775 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033439 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033439 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033439 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008491 MISSION® esiRNA esiRNA targeting human IL33 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033439 Rosetta Predictions human pricing
NM_001014166 Rosetta Predictions rat pricing
NM_133775 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129936 predicted 758
2 SASI_Hs01_00129937 predicted 483
3 SASI_Hs01_00129938 predicted 498
4 SASI_Hs01_00129939 predicted 488
5 SASI_Hs01_00129940 predicted 335
6 SASI_Hs02_00361334 predicted 730
7 SASI_Hs01_00129941 predicted 391
8 SASI_Hs01_00129943 predicted 262
9 SASI_Hs02_00361335 predicted 907
10 SASI_Hs01_00129944 predicted 373
11 SASI_Hs01_00129942 predicted 827
12 SASI_Hs01_00129945 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014166 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032430 predicted 623
2 SASI_Rn01_00032432 predicted 470
3 SASI_Rn01_00032433 predicted 785
4 SASI_Rn02_00201655 predicted 819
5 SASI_Rn01_00032434 predicted 597
6 SASI_Rn02_00201656 predicted 808
7 SASI_Rn01_00032435 predicted 391
8 SASI_Rn02_00201657 predicted 380
9 SASI_Rn01_00032437 predicted 834
10 SASI_Rn01_00032438 predicted 364
11 SASI_Rn01_00032431 predicted 818
12 SASI_Rn01_00032436 predicted 437
13 SASI_Rn01_00032439 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133775 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043765 predicted 354
2 SASI_Mm01_00043766 predicted 446
3 SASI_Mm01_00043768 predicted 497
4 SASI_Mm01_00043769 predicted 784
5 SASI_Mm02_00338788 predicted 330
6 SASI_Mm01_00043770 predicted 734
7 SASI_Mm01_00043771 predicted 411
8 SASI_Mm01_00043772 predicted 602
9 SASI_Mm01_00043773 predicted 574
10 SASI_Mm01_00043774 predicted 435
11 SASI_Mm01_00043767 predicted 705
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133775
VALIDATED
IL33 MISSION shRNA Bacterial Glycerol Stock
interleukin 33
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133775.1-1614s21c1
Sequence:CCGGGCCAATAGAATGGGATCTCATCTCGAGATGAGATCCCATTCTATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133775.1-362s21c1
Sequence:CCGGGCATCCAAGGAACTTCACTTTCTCGAGAAAGTGAAGTTCCTTGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133775.1-1221s21c1
Sequence:CCGGCCTGGTTCTAAACAAATGATTCTCGAGAATCATTTGTTTAGAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133775.1-798s1c1
Sequence:CCGGGAGCTGCAACAATATTATGTTCTCGAGAACATAATATTGTTGCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133775.1-1614s1c1
Sequence:CCGGGCCAATAGAATGGGATCTCATCTCGAGATGAGATCCCATTCTATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133775.1-362s1c1
Sequence:CCGGGCATCCAAGGAACTTCACTTTCTCGAGAAAGTGAAGTTCCTTGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133775.1-197s1c1
Sequence:CCGGCCATAAGAAAGGAGACTAGTTCTCGAGAACTAGTCTCCTTTCTTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133775.1-197s21c1
Sequence:CCGGCCATAAGAAAGGAGACTAGTTCTCGAGAACTAGTCTCCTTTCTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133775.1-1221s1c1
Sequence:CCGGCCTGGTTCTAAACAAATGATTCTCGAGAATCATTTGTTTAGAACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133775.1-448s1c1
Sequence:CCGGGGATGTTATGTGATCAATGTTCTCGAGAACATTGATCACATAACATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133775
VALIDATED
IL33 MISSION shRNA shRNA Plasmid DNA
interleukin 33
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133775.1-1614s21c1
Sequence:CCGGGCCAATAGAATGGGATCTCATCTCGAGATGAGATCCCATTCTATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133775.1-362s21c1
Sequence:CCGGGCATCCAAGGAACTTCACTTTCTCGAGAAAGTGAAGTTCCTTGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133775.1-1221s21c1
Sequence:CCGGCCTGGTTCTAAACAAATGATTCTCGAGAATCATTTGTTTAGAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133775.1-798s1c1
Sequence:CCGGGAGCTGCAACAATATTATGTTCTCGAGAACATAATATTGTTGCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133775.1-1614s1c1
Sequence:CCGGGCCAATAGAATGGGATCTCATCTCGAGATGAGATCCCATTCTATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133775.1-362s1c1
Sequence:CCGGGCATCCAAGGAACTTCACTTTCTCGAGAAAGTGAAGTTCCTTGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133775.1-197s1c1
Sequence:CCGGCCATAAGAAAGGAGACTAGTTCTCGAGAACTAGTCTCCTTTCTTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133775.1-197s21c1
Sequence:CCGGCCATAAGAAAGGAGACTAGTTCTCGAGAACTAGTCTCCTTTCTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133775.1-1221s1c1
Sequence:CCGGCCTGGTTCTAAACAAATGATTCTCGAGAATCATTTGTTTAGAACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133775.1-448s1c1
Sequence:CCGGGGATGTTATGTGATCAATGTTCTCGAGAACATTGATCACATAACATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133775
VALIDATED
IL33 MISSION shRNA Lentiviral Transduction Particles
interleukin 33
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133775.1-1614s21c1
Sequence:CCGGGCCAATAGAATGGGATCTCATCTCGAGATGAGATCCCATTCTATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133775.1-362s21c1
Sequence:CCGGGCATCCAAGGAACTTCACTTTCTCGAGAAAGTGAAGTTCCTTGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133775.1-1221s21c1
Sequence:CCGGCCTGGTTCTAAACAAATGATTCTCGAGAATCATTTGTTTAGAACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133775.1-798s1c1
Sequence:CCGGGAGCTGCAACAATATTATGTTCTCGAGAACATAATATTGTTGCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133775.1-1614s1c1
Sequence:CCGGGCCAATAGAATGGGATCTCATCTCGAGATGAGATCCCATTCTATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133775.1-362s1c1
Sequence:CCGGGCATCCAAGGAACTTCACTTTCTCGAGAAAGTGAAGTTCCTTGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133775.1-197s1c1
Sequence:CCGGCCATAAGAAAGGAGACTAGTTCTCGAGAACTAGTCTCCTTTCTTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133775.1-197s21c1
Sequence:CCGGCCATAAGAAAGGAGACTAGTTCTCGAGAACTAGTCTCCTTTCTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133775.1-1221s1c1
Sequence:CCGGCCTGGTTCTAAACAAATGATTCTCGAGAATCATTTGTTTAGAACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133775.1-448s1c1
Sequence:CCGGGGATGTTATGTGATCAATGTTCTCGAGAACATTGATCACATAACATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033439
IL33 MISSION shRNA Bacterial Glycerol Stock
interleukin 33
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000135846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-61s1c1
Sequence:CCGGCAAAGTGGAAGAACACAGCAACTCGAGTTGCTGTGTTCTTCCACTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-187s1c1
Sequence:CCGGCCTGTTACTTTAGGAGAGAAACTCGAGTTTCTCTCCTAAAGTAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-593s1c1
Sequence:CCGGCTGGTTGCATGCCAACAACAACTCGAGTTGTTGTTGGCATGCAACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-674s1c1
Sequence:CCGGCCTTCATAATATGCACTCCAACTCGAGTTGGAGTGCATATTATGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-291s1c1
Sequence:CCGGGAGTGCTTTGCCTTTGGTATACTCGAGTATACCAAAGGCAAAGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-186s1c1
Sequence:CCGGGCCTGTTACTTTAGGAGAGAACTCGAGTTCTCTCCTAAAGTAACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-194s1c1
Sequence:CCGGCTTTAGGAGAGAAACCACCAACTCGAGTTGGTGGTTTCTCTCCTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-531s1c1
Sequence:CCGGGAATCAGGTGACGGTGTTGATCTCGAGATCAACACCGTCACCTGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-686s1c1
Sequence:CCGGGCACTCCAACTGTGTTTCATTCTCGAGAATGAAACACAGTTGGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033439
IL33 MISSION shRNA shRNA Plasmid DNA
interleukin 33
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000135846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-61s1c1
Sequence:CCGGCAAAGTGGAAGAACACAGCAACTCGAGTTGCTGTGTTCTTCCACTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-187s1c1
Sequence:CCGGCCTGTTACTTTAGGAGAGAAACTCGAGTTTCTCTCCTAAAGTAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-593s1c1
Sequence:CCGGCTGGTTGCATGCCAACAACAACTCGAGTTGTTGTTGGCATGCAACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-674s1c1
Sequence:CCGGCCTTCATAATATGCACTCCAACTCGAGTTGGAGTGCATATTATGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-291s1c1
Sequence:CCGGGAGTGCTTTGCCTTTGGTATACTCGAGTATACCAAAGGCAAAGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-186s1c1
Sequence:CCGGGCCTGTTACTTTAGGAGAGAACTCGAGTTCTCTCCTAAAGTAACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-194s1c1
Sequence:CCGGCTTTAGGAGAGAAACCACCAACTCGAGTTGGTGGTTTCTCTCCTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-531s1c1
Sequence:CCGGGAATCAGGTGACGGTGTTGATCTCGAGATCAACACCGTCACCTGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-686s1c1
Sequence:CCGGGCACTCCAACTGTGTTTCATTCTCGAGAATGAAACACAGTTGGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033439
IL33 MISSION shRNA Lentiviral Transduction Particles
interleukin 33
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000135846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-61s1c1
Sequence:CCGGCAAAGTGGAAGAACACAGCAACTCGAGTTGCTGTGTTCTTCCACTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-187s1c1
Sequence:CCGGCCTGTTACTTTAGGAGAGAAACTCGAGTTTCTCTCCTAAAGTAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-593s1c1
Sequence:CCGGCTGGTTGCATGCCAACAACAACTCGAGTTGTTGTTGGCATGCAACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-674s1c1
Sequence:CCGGCCTTCATAATATGCACTCCAACTCGAGTTGGAGTGCATATTATGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-291s1c1
Sequence:CCGGGAGTGCTTTGCCTTTGGTATACTCGAGTATACCAAAGGCAAAGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-186s1c1
Sequence:CCGGGCCTGTTACTTTAGGAGAGAACTCGAGTTCTCTCCTAAAGTAACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-194s1c1
Sequence:CCGGCTTTAGGAGAGAAACCACCAACTCGAGTTGGTGGTTTCTCTCCTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-531s1c1
Sequence:CCGGGAATCAGGTGACGGTGTTGATCTCGAGATCAACACCGTCACCTGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033439.1-686s1c1
Sequence:CCGGGCACTCCAACTGTGTTTCATTCTCGAGAATGAAACACAGTTGGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)