EMAIL THIS PAGE TO A FRIEND

IL34

interleukin 34

53 Gene Product Result for
Synonyms: C16orf77 IL-34
UniProtKB ID: Q6ZMJ4, B2RC28, B2Z4A8, B2ZC70, Q8N6L2
Gene ID:
Human(146433) Summary: Interleukin-34 is a cytokine that promotes the differentiation and viability of monocytes and macrophages through the colony-stimulating factor-1 receptor (CSF1R; MIM 164770) (Lin et al., 2008 [PubMed 18467591]
Mouse(76527) interleukin 34
Rat(498951) interleukin 34
naked mole-rat(101724161) interleukin 34
sheep(101113261) interleukin 34
Zebrafish(100004224) interleukin 34
cow(508292) interleukin 34
domestic cat(101094391) interleukin 34
dog(610536) interleukin 34
chicken(100858424) interleukin 34
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0699 Human IL34 / Interleukin-34 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029646 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029646 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029646 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152456 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152456 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152456 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048781 MISSION® esiRNA esiRNA human IL34 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152456 Rosetta Predictions human pricing
NM_001025766 Rosetta Predictions rat pricing
NM_029646 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243325 predicted 524
2 SASI_Hs02_00366232 predicted 899
3 SASI_Hs01_00243326 predicted 477
4 SASI_Hs01_00243327 predicted 807
5 SASI_Hs01_00243328 predicted 902
6 SASI_Hs01_00243329 predicted 927
7 SASI_Hs01_00243330 predicted 391
8 SASI_Hs01_00243331 predicted 463
9 SASI_Hs01_00243332 predicted 1269
10 SASI_Hs01_00243333 predicted 388
11 SASI_Hs01_00243334 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025766 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072227 predicted 1164
2 SASI_Rn02_00203442 predicted 676
3 SASI_Rn01_00072228 predicted 970
4 SASI_Rn01_00072229 predicted 565
5 SASI_Rn01_00072230 predicted 998
6 SASI_Rn01_00072231 predicted 1294
7 SASI_Rn01_00072232 predicted 452
8 SASI_Rn01_00072234 predicted 795
9 SASI_Rn02_00203443 predicted 1163
10 SASI_Rn02_00203444 predicted 998
11 SASI_Rn01_00072226 predicted 678
12 SASI_Rn01_00072233 predicted 612
13 SASI_Rn01_00072235 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029646 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070503 predicted 1335
2 SASI_Mm01_00070504 predicted 1271
3 SASI_Mm01_00070505 predicted 709
4 SASI_Mm01_00070506 predicted 920
5 SASI_Mm01_00070507 predicted 1166
6 SASI_Mm01_00070508 predicted 1068
7 SASI_Mm01_00070509 predicted 629
8 SASI_Mm01_00070510 predicted 1495
9 SASI_Mm01_00070512 predicted 1003
10 SASI_Mm02_00335639 predicted 764
11 SASI_Mm01_00070511 predicted 1078
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029646
IL34 MISSION shRNA Bacterial Glycerol Stock
interleukin 34
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029646.1-567s1c1
Sequence:CCGGGATCCTACTTGACGTGGCTTTCTCGAGAAAGCCACGTCAAGTAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029646.1-679s1c1
Sequence:CCGGCGGCTTCAGTACATGAAACATCTCGAGATGTTTCATGTACTGAAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029646.2-1293s21c1
Sequence:CCGGATGCAATGTACAGCTACAAATCTCGAGATTTGTAGCTGTACATTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215544    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029646.1-1261s1c1
Sequence:CCGGGATGCAATGTACAGCTACAAACTCGAGTTTGTAGCTGTACATTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029646.2-1099s21c1
Sequence:CCGGCTCACGTGGAAGCTGTGTTATCTCGAGATAACACAGCTTCCACGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029646.2-640s21c1
Sequence:CCGGATGGACTCTGACCCAAGATAACTCGAGTTATCTTGGGTCAGAGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029646.2-708s21c1
Sequence:CCGGACCGGCTTCAGTACATGAAACCTCGAGGTTTCATGTACTGAAGCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029646.2-1031s21c1
Sequence:CCGGAGCCCATGGGCCAGATCATTTCTCGAGAAATGATCTGGCCCATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029646
IL34 MISSION shRNA shRNA Plasmid DNA
interleukin 34
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029646.1-567s1c1
Sequence:CCGGGATCCTACTTGACGTGGCTTTCTCGAGAAAGCCACGTCAAGTAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029646.1-679s1c1
Sequence:CCGGCGGCTTCAGTACATGAAACATCTCGAGATGTTTCATGTACTGAAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029646.2-1293s21c1
Sequence:CCGGATGCAATGTACAGCTACAAATCTCGAGATTTGTAGCTGTACATTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215544    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029646.1-1261s1c1
Sequence:CCGGGATGCAATGTACAGCTACAAACTCGAGTTTGTAGCTGTACATTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029646.2-1099s21c1
Sequence:CCGGCTCACGTGGAAGCTGTGTTATCTCGAGATAACACAGCTTCCACGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029646.2-640s21c1
Sequence:CCGGATGGACTCTGACCCAAGATAACTCGAGTTATCTTGGGTCAGAGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029646.2-708s21c1
Sequence:CCGGACCGGCTTCAGTACATGAAACCTCGAGGTTTCATGTACTGAAGCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029646.2-1031s21c1
Sequence:CCGGAGCCCATGGGCCAGATCATTTCTCGAGAAATGATCTGGCCCATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029646
IL34 MISSION shRNA Lentiviral Transduction Particles
interleukin 34
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029646.1-567s1c1
Sequence:CCGGGATCCTACTTGACGTGGCTTTCTCGAGAAAGCCACGTCAAGTAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029646.1-679s1c1
Sequence:CCGGCGGCTTCAGTACATGAAACATCTCGAGATGTTTCATGTACTGAAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029646.2-1293s21c1
Sequence:CCGGATGCAATGTACAGCTACAAATCTCGAGATTTGTAGCTGTACATTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215544    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029646.1-1261s1c1
Sequence:CCGGGATGCAATGTACAGCTACAAACTCGAGTTTGTAGCTGTACATTGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029646.2-1099s21c1
Sequence:CCGGCTCACGTGGAAGCTGTGTTATCTCGAGATAACACAGCTTCCACGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029646.2-640s21c1
Sequence:CCGGATGGACTCTGACCCAAGATAACTCGAGTTATCTTGGGTCAGAGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029646.2-708s21c1
Sequence:CCGGACCGGCTTCAGTACATGAAACCTCGAGGTTTCATGTACTGAAGCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029646.2-1031s21c1
Sequence:CCGGAGCCCATGGGCCAGATCATTTCTCGAGAAATGATCTGGCCCATGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152456
IL34 MISSION shRNA Bacterial Glycerol Stock
interleukin 34
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152456.1-922s1c1
Sequence:CCGGGTAAACAAAGCTCCGTCCTAACTCGAGTTAGGACGGAGCTTTGTTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152456.1-537s1c1
Sequence:CCGGCAGTACATGAAACACTACTTCCTCGAGGAAGTAGTGTTTCATGTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152456.1-560s1c1
Sequence:CCGGCATCAACTACAAGATCAGTGTCTCGAGACACTGATCTTGTAGTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152456.1-534s1c1
Sequence:CCGGCTTCAGTACATGAAACACTACCTCGAGGTAGTGTTTCATGTACTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152456.1-532s1c1
Sequence:CCGGGACTTCAGTACATGAAACACTCTCGAGAGTGTTTCATGTACTGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152456.1-529s1c1
Sequence:CCGGGCCGACTTCAGTACATGAAACCTCGAGGTTTCATGTACTGAAGTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152456.1-985s21c1
Sequence:CCGGCAGAGCCCTCATTGCAGTATGCTCGAGCATACTGCAATGAGGGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152456.1-814s21c1
Sequence:CCGGCCGTGTTGTCCCTCTTGAATGCTCGAGCATTCAAGAGGGACAACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152456.1-907s21c1
Sequence:CCGGTGTACTGCTCCTGCTGTAAACCTCGAGGTTTACAGCAGGAGCAGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152456
IL34 MISSION shRNA shRNA Plasmid DNA
interleukin 34
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152456.1-922s1c1
Sequence:CCGGGTAAACAAAGCTCCGTCCTAACTCGAGTTAGGACGGAGCTTTGTTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152456.1-537s1c1
Sequence:CCGGCAGTACATGAAACACTACTTCCTCGAGGAAGTAGTGTTTCATGTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152456.1-560s1c1
Sequence:CCGGCATCAACTACAAGATCAGTGTCTCGAGACACTGATCTTGTAGTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152456.1-534s1c1
Sequence:CCGGCTTCAGTACATGAAACACTACCTCGAGGTAGTGTTTCATGTACTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152456.1-532s1c1
Sequence:CCGGGACTTCAGTACATGAAACACTCTCGAGAGTGTTTCATGTACTGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152456.1-529s1c1
Sequence:CCGGGCCGACTTCAGTACATGAAACCTCGAGGTTTCATGTACTGAAGTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152456.1-985s21c1
Sequence:CCGGCAGAGCCCTCATTGCAGTATGCTCGAGCATACTGCAATGAGGGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152456.1-814s21c1
Sequence:CCGGCCGTGTTGTCCCTCTTGAATGCTCGAGCATTCAAGAGGGACAACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152456.1-907s21c1
Sequence:CCGGTGTACTGCTCCTGCTGTAAACCTCGAGGTTTACAGCAGGAGCAGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152456
IL34 MISSION shRNA Lentiviral Transduction Particles
interleukin 34
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152456.1-922s1c1
Sequence:CCGGGTAAACAAAGCTCCGTCCTAACTCGAGTTAGGACGGAGCTTTGTTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152456.1-537s1c1
Sequence:CCGGCAGTACATGAAACACTACTTCCTCGAGGAAGTAGTGTTTCATGTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152456.1-560s1c1
Sequence:CCGGCATCAACTACAAGATCAGTGTCTCGAGACACTGATCTTGTAGTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152456.1-534s1c1
Sequence:CCGGCTTCAGTACATGAAACACTACCTCGAGGTAGTGTTTCATGTACTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152456.1-532s1c1
Sequence:CCGGGACTTCAGTACATGAAACACTCTCGAGAGTGTTTCATGTACTGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152456.1-529s1c1
Sequence:CCGGGCCGACTTCAGTACATGAAACCTCGAGGTTTCATGTACTGAAGTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152456.1-985s21c1
Sequence:CCGGCAGAGCCCTCATTGCAGTATGCTCGAGCATACTGCAATGAGGGCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152456.1-814s21c1
Sequence:CCGGCCGTGTTGTCCCTCTTGAATGCTCGAGCATTCAAGAGGGACAACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152456.1-907s21c1
Sequence:CCGGTGTACTGCTCCTGCTGTAAACCTCGAGGTTTACAGCAGGAGCAGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)