EMAIL THIS PAGE TO A FRIEND

IL36B

interleukin 36, beta

53 Gene Product Result for
Synonyms: FIL1 FIL1-(ETA) FIL1H FILI-(ETA) IL-1F8 IL-1H2 IL1-ETA IL1F8 IL1H2
UniProtKB ID: Q9NZH7, Q3MIH0, Q53SR6, Q7RTZ7, Q9UHA5
Gene ID:
Human(27177) Summary: The protein encoded by this gene is a member of the interleukin 1 cytokine family. Protein structure modeling indicated that this cytokine may contain a 12-stranded beta-trefoil structure that is conserved between IL1A (IL-A alpha) and IL1B (IL-1 beta). This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. Two alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Rat(362076) interleukin 36, beta
naked mole-rat(101726112) interleukin 36, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0688 Human IL36B / Interleukin-36 Beta ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014438 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014438 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014438 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014438 Rosetta Predictions human pricing
NM_173178 Rosetta Predictions human pricing
NM_001108570 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230657 predicted 891
2 SASI_Hs01_00230658 predicted 530
3 SASI_Hs01_00230660 predicted 212
4 SASI_Hs01_00230661 predicted 410
5 SASI_Hs01_00230662 predicted 654
6 SASI_Hs01_00230663 predicted 546
7 SASI_Hs01_00230664 predicted 193
8 SASI_Hs01_00230666 predicted 323
9 SASI_Hs02_00345645 predicted 423
10 SASI_Hs02_00345646 predicted 800
11 SASI_Hs01_00230659 predicted 485
12 SASI_Hs01_00230665 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111548 predicted 618
2 SASI_Hs01_00111549 predicted 251
3 SASI_Hs01_00111550 predicted 525
4 SASI_Hs01_00111551 predicted 343
5 SASI_Hs01_00111552 predicted 431
6 SASI_Hs01_00111553 predicted 627
7 SASI_Hs01_00111555 predicted 630
8 SASI_Hs01_00111556 predicted 199
9 SASI_Hs01_00111557 predicted 637
10 SASI_Hs02_00368147 predicted 442
11 SASI_Hs01_00111554 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108570 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239939 predicted 279
2 SASI_Rn02_00239940 predicted 273
3 SASI_Rn02_00239941 predicted 332
4 SASI_Rn02_00239942 predicted 259
5 SASI_Rn02_00239943 predicted 208
6 SASI_Rn02_00239944 predicted 338
7 SASI_Rn02_00239945 predicted 270
8 SASI_Rn02_00239946 predicted 241
9 SASI_Rn02_00239947 predicted 265
10 SASI_Rn02_00239948 predicted 294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014438
IL36B MISSION shRNA Bacterial Glycerol Stock
interleukin 36, beta
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014438.3-343s1c1
Sequence:CCGGGCAAGCCTACTTTGCAGCTTACTCGAGTAAGCTGCAAAGTAGGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014438.3-173s1c1
Sequence:CCGGCCTGAGTGGAAATTCTTTAATCTCGAGATTAAAGAATTTCCACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014438.3-374s1c1
Sequence:CCGGCTCCCAAGATAACATAGGGAACTCGAGTTCCCTATGTTATCTTGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014438.3-530s1c1
Sequence:CCGGCCATCTCAGGAAGAAGGACAACTCGAGTTGTCCTTCTTCCTGAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014438.3-222s1c1
Sequence:CCGGCCTGTCACTCTTCATTTAATACTCGAGTATTAAATGAAGAGTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014438.3-134s21c1
Sequence:CCGGATCCTATGCTATTCGTGATTCCTCGAGGAATCACGAATAGCATAGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014438.3-805s21c1
Sequence:CCGGTTGGACTACATAACCTGTAAACTCGAGTTTACAGGTTATGTAGTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014438
IL36B MISSION shRNA shRNA Plasmid DNA
interleukin 36, beta
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014438.3-343s1c1
Sequence:CCGGGCAAGCCTACTTTGCAGCTTACTCGAGTAAGCTGCAAAGTAGGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014438.3-173s1c1
Sequence:CCGGCCTGAGTGGAAATTCTTTAATCTCGAGATTAAAGAATTTCCACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014438.3-374s1c1
Sequence:CCGGCTCCCAAGATAACATAGGGAACTCGAGTTCCCTATGTTATCTTGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014438.3-530s1c1
Sequence:CCGGCCATCTCAGGAAGAAGGACAACTCGAGTTGTCCTTCTTCCTGAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014438.3-222s1c1
Sequence:CCGGCCTGTCACTCTTCATTTAATACTCGAGTATTAAATGAAGAGTGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014438.3-134s21c1
Sequence:CCGGATCCTATGCTATTCGTGATTCCTCGAGGAATCACGAATAGCATAGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014438.3-805s21c1
Sequence:CCGGTTGGACTACATAACCTGTAAACTCGAGTTTACAGGTTATGTAGTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014438
IL36B MISSION shRNA Lentiviral Transduction Particles
interleukin 36, beta
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014438.3-343s1c1
Sequence:CCGGGCAAGCCTACTTTGCAGCTTACTCGAGTAAGCTGCAAAGTAGGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014438.3-173s1c1
Sequence:CCGGCCTGAGTGGAAATTCTTTAATCTCGAGATTAAAGAATTTCCACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014438.3-374s1c1
Sequence:CCGGCTCCCAAGATAACATAGGGAACTCGAGTTCCCTATGTTATCTTGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014438.3-530s1c1
Sequence:CCGGCCATCTCAGGAAGAAGGACAACTCGAGTTGTCCTTCTTCCTGAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014438.3-222s1c1
Sequence:CCGGCCTGTCACTCTTCATTTAATACTCGAGTATTAAATGAAGAGTGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014438.3-134s21c1
Sequence:CCGGATCCTATGCTATTCGTGATTCCTCGAGGAATCACGAATAGCATAGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014438.3-805s21c1
Sequence:CCGGTTGGACTACATAACCTGTAAACTCGAGTTTACAGGTTATGTAGTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)