EMAIL THIS PAGE TO A FRIEND

IL36G

interleukin 36, gamma

75 Gene Product Result for
Synonyms: IL-1F9 IL-1H1 IL-1RP2 IL1E IL1F9 IL1H1 IL1RP2
UniProtKB ID: Q9NZH8, Q56B91, Q6UVX7, Q7RTZ9
Gene ID:
Human(56300) Summary: The protein encoded by this gene is a member of the interleukin 1 cytokine family. The activity of this cytokine is mediated by interleukin 1 receptor-like 2 (IL1RL2/IL1R-rp2), and is specifically inhibited by interleukin 1 family, member 5 (IL1F5/IL-1 delta). Interferon-gamma, tumor necrosis factor-alpha and interleukin 1, beta (IL1B) are reported to stimulate the expression of this cytokine in keratinocytes. The expression of this cytokine in keratinocytes can also be induced by a contact hypersensitivity reaction or herpes simplex virus infection. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
Rat(499744) interleukin 36, gamma
cow(615762) interleukin 36, gamma
domestic cat(101081377) interleukin 36, gamma
dog(100686137) interleukin 36, gamma
naked mole-rat(101725374) interleukin 36, gamma
sheep(101106514) interleukin 36, gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0689 Human IL36G / Interleukin-36 Gamma ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019618 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019618 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019618 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018531 MISSION® esiRNA esiRNA targeting human IL1F9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019618 Rosetta Predictions human pricing
NM_001113790 Rosetta Predictions rat pricing
XM_575079 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133920 predicted 841
2 SASI_Hs01_00133921 predicted 537
3 SASI_Hs01_00133923 predicted 846
4 SASI_Hs01_00133924 predicted 522
5 SASI_Hs01_00133925 predicted 495
6 SASI_Hs01_00133926 predicted 497
7 SASI_Hs01_00133927 predicted 368
8 SASI_Hs01_00133928 predicted 910
9 SASI_Hs01_00133929 predicted 530
10 SASI_Hs02_00352836 predicted 281
11 SASI_Hs01_00133922 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113790 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252153 predicted 302
2 SASI_Rn02_00252154 predicted 640
3 SASI_Rn02_00252155 predicted 822
4 SASI_Rn02_00252156 predicted 740
5 SASI_Rn02_00252157 predicted 703
6 SASI_Rn02_00252158 predicted 493
7 SASI_Rn02_00252159 predicted 734
8 SASI_Rn02_00252160 predicted 696
9 SASI_Rn02_00252161 predicted 580
10 SASI_Rn02_00252162 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575079 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00186057 predicted 315
2 SASI_Rn01_00186058 predicted 362
3 SASI_Rn01_00186059 predicted 253
4 SASI_Rn01_00186060 predicted 369
5 SASI_Rn01_00186061 predicted 359
6 SASI_Rn01_00186062 predicted 216
7 SASI_Rn01_00186063 predicted 346
8 SASI_Rn01_00186064 predicted 219
9 SASI_Rn01_00186065 predicted 303
10 SASI_Rn01_00186066 predicted 247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019618
IL36G MISSION shRNA Bacterial Glycerol Stock
interleukin 36, gamma
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019618.2-300s21c1
Sequence:CCGGGGGAATCCAGAATCCAGAAATCTCGAGATTTCTGGATTCTGGATTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019618.2-990s21c1
Sequence:CCGGTGATATCATCCAGTCTTTATACTCGAGTATAAAGACTGGATGATATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019618.2-774s21c1
Sequence:CCGGCAGGAGAGCTGGGTGGTATAACTCGAGTTATACCACCCAGCTCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019618.2-111s1c1
Sequence:CCGGCGTCTATCAATCAATGTGTAACTCGAGTTACACATTGATTGATAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019618.2-372s1c1
Sequence:CCGGGCAGAAGATCATGGATCTGTACTCGAGTACAGATCCATGATCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019618.2-238s1c1
Sequence:CCGGGCTGTTATCACATGCAAGTATCTCGAGATACTTGCATGTGATAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019618.2-128s1c1
Sequence:CCGGGTAAACCTATTACTGGGACTACTCGAGTAGTCCCAGTAATAGGTTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019618.2-511s1c1
Sequence:CCGGCCCATCATTCTGACTTCAGAACTCGAGTTCTGAAGTCAGAATGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019618
IL36G MISSION shRNA shRNA Plasmid DNA
interleukin 36, gamma
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019618.2-300s21c1
Sequence:CCGGGGGAATCCAGAATCCAGAAATCTCGAGATTTCTGGATTCTGGATTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019618.2-990s21c1
Sequence:CCGGTGATATCATCCAGTCTTTATACTCGAGTATAAAGACTGGATGATATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019618.2-774s21c1
Sequence:CCGGCAGGAGAGCTGGGTGGTATAACTCGAGTTATACCACCCAGCTCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019618.2-111s1c1
Sequence:CCGGCGTCTATCAATCAATGTGTAACTCGAGTTACACATTGATTGATAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019618.2-372s1c1
Sequence:CCGGGCAGAAGATCATGGATCTGTACTCGAGTACAGATCCATGATCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019618.2-238s1c1
Sequence:CCGGGCTGTTATCACATGCAAGTATCTCGAGATACTTGCATGTGATAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019618.2-128s1c1
Sequence:CCGGGTAAACCTATTACTGGGACTACTCGAGTAGTCCCAGTAATAGGTTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019618.2-511s1c1
Sequence:CCGGCCCATCATTCTGACTTCAGAACTCGAGTTCTGAAGTCAGAATGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019618
IL36G MISSION shRNA Lentiviral Transduction Particles
interleukin 36, gamma
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019618.2-300s21c1
Sequence:CCGGGGGAATCCAGAATCCAGAAATCTCGAGATTTCTGGATTCTGGATTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019618.2-990s21c1
Sequence:CCGGTGATATCATCCAGTCTTTATACTCGAGTATAAAGACTGGATGATATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019618.2-774s21c1
Sequence:CCGGCAGGAGAGCTGGGTGGTATAACTCGAGTTATACCACCCAGCTCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019618.2-111s1c1
Sequence:CCGGCGTCTATCAATCAATGTGTAACTCGAGTTACACATTGATTGATAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019618.2-372s1c1
Sequence:CCGGGCAGAAGATCATGGATCTGTACTCGAGTACAGATCCATGATCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019618.2-238s1c1
Sequence:CCGGGCTGTTATCACATGCAAGTATCTCGAGATACTTGCATGTGATAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019618.2-128s1c1
Sequence:CCGGGTAAACCTATTACTGGGACTACTCGAGTAGTCCCAGTAATAGGTTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019618.2-511s1c1
Sequence:CCGGCCCATCATTCTGACTTCAGAACTCGAGTTCTGAAGTCAGAATGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)