EMAIL THIS PAGE TO A FRIEND

IL36RN

interleukin 36 receptor antagonist

86 Gene Product Result for
Synonyms: FIL1 FIL1(DELTA) FIL1D IL1F5 IL1HY1 IL1L1 IL1RP3 IL36RA PSORP
UniProtKB ID: Q9UBH0, A8K2I4, Q56AT9, Q7RTZ6
Gene ID:
Human(26525) Summary: The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine was shown to specifically inhibit the activation of NF-kappaB induced by interleukin 1 family, member 6 (IL1F6). This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. Two alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
Rat(311783) interleukin 36 receptor antagonist
sheep(101111354) interleukin 36 receptor antagonist
domestic guinea pig(100722417) interleukin 36 receptor antagonist
naked mole-rat(101705618) interleukin 36 receptor antagonist
chicken(100861586) interleukin 36 receptor antagonist
cow(518514) interleukin 36 receptor antagonist
domestic cat(101097230) interleukin 36 receptor antagonist
dog(611869) interleukin 36 receptor antagonist
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0685 Human IL36RN / Interleukin-36 Receptor Antagonist Protein ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012275 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012275 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012275 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066751 MISSION® esiRNA esiRNA human IL1F5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012275 Rosetta Predictions human pricing
NM_173170 Rosetta Predictions human pricing
NM_001107814 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221822 predicted 422
2 SASI_Hs01_00221823 predicted 763
3 SASI_Hs01_00221824 predicted 915
4 SASI_Hs01_00221825 predicted 540
5 SASI_Hs01_00221826 predicted 920
6 SASI_Hs01_00221827 predicted 554
7 SASI_Hs01_00221828 predicted 743
8 SASI_Hs01_00221829 predicted 1061
9 SASI_Hs01_00221830 predicted 985
10 SASI_Hs01_00221831 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235166 predicted 387
2 SASI_Hs01_00235167 predicted 737
3 SASI_Hs01_00235168 predicted 893
4 SASI_Hs01_00235169 predicted 509
5 SASI_Hs01_00235170 predicted 887
6 SASI_Hs01_00235171 predicted 522
7 SASI_Hs01_00235172 predicted 715
8 SASI_Hs01_00235173 predicted 1033
9 SASI_Hs01_00235174 predicted 962
10 SASI_Hs01_00235175 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107814 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232535 predicted 760
2 SASI_Rn02_00232536 predicted 351
3 SASI_Rn02_00232537 predicted 1022
4 SASI_Rn02_00232538 predicted 848
5 SASI_Rn02_00232539 predicted 338
6 SASI_Rn02_00232540 predicted 423
7 SASI_Rn02_00232541 predicted 947
8 SASI_Rn02_00232542 predicted 933
9 SASI_Rn02_00232543 predicted 364
10 SASI_Rn02_00232544 predicted 998
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012275
IL36RN MISSION shRNA Bacterial Glycerol Stock
interleukin 36 receptor antagonist
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012275.2-200s1c1
Sequence:CCGGCTCGGCATTGAAGGTGCTTTACTCGAGTAAAGCACCTTCAATGCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012275.2-258s1c1
Sequence:CCGGGCAGGGAAGGTCATTAAAGGTCTCGAGACCTTTAATGACCTTCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012275.2-570s1c1
Sequence:CCGGCCCGAGAATGGTGGCTGGAATCTCGAGATTCCAGCCACCATTCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012275.2-222s1c1
Sequence:CCGGCTGCATAATAACCAGCTTCTACTCGAGTAGAAGCTGGTTATTATGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012275.2-424s1c1
Sequence:CCGGTCTATCTTGGTGCCAAGGAATCTCGAGATTCCTTGGCACCAAGATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012275.2-770s21c1
Sequence:CCGGTGGTTCCCAGTTTGGATAAATCTCGAGATTTATCCAAACTGGGAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012275.2-381s21c1
Sequence:CCGGCAGGAGCCGACTCTAACACTACTCGAGTAGTGTTAGAGTCGGCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012275.2-925s21c1
Sequence:CCGGGGGAATCATTCCTGCTTAATGCTCGAGCATTAAGCAGGAATGATTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012275
IL36RN MISSION shRNA shRNA Plasmid DNA
interleukin 36 receptor antagonist
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012275.2-200s1c1
Sequence:CCGGCTCGGCATTGAAGGTGCTTTACTCGAGTAAAGCACCTTCAATGCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012275.2-258s1c1
Sequence:CCGGGCAGGGAAGGTCATTAAAGGTCTCGAGACCTTTAATGACCTTCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012275.2-570s1c1
Sequence:CCGGCCCGAGAATGGTGGCTGGAATCTCGAGATTCCAGCCACCATTCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012275.2-222s1c1
Sequence:CCGGCTGCATAATAACCAGCTTCTACTCGAGTAGAAGCTGGTTATTATGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012275.2-424s1c1
Sequence:CCGGTCTATCTTGGTGCCAAGGAATCTCGAGATTCCTTGGCACCAAGATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012275.2-770s21c1
Sequence:CCGGTGGTTCCCAGTTTGGATAAATCTCGAGATTTATCCAAACTGGGAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012275.2-381s21c1
Sequence:CCGGCAGGAGCCGACTCTAACACTACTCGAGTAGTGTTAGAGTCGGCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012275.2-925s21c1
Sequence:CCGGGGGAATCATTCCTGCTTAATGCTCGAGCATTAAGCAGGAATGATTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012275
IL36RN MISSION shRNA Lentiviral Transduction Particles
interleukin 36 receptor antagonist
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012275.2-200s1c1
Sequence:CCGGCTCGGCATTGAAGGTGCTTTACTCGAGTAAAGCACCTTCAATGCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012275.2-258s1c1
Sequence:CCGGGCAGGGAAGGTCATTAAAGGTCTCGAGACCTTTAATGACCTTCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012275.2-570s1c1
Sequence:CCGGCCCGAGAATGGTGGCTGGAATCTCGAGATTCCAGCCACCATTCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012275.2-222s1c1
Sequence:CCGGCTGCATAATAACCAGCTTCTACTCGAGTAGAAGCTGGTTATTATGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012275.2-424s1c1
Sequence:CCGGTCTATCTTGGTGCCAAGGAATCTCGAGATTCCTTGGCACCAAGATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012275.2-770s21c1
Sequence:CCGGTGGTTCCCAGTTTGGATAAATCTCGAGATTTATCCAAACTGGGAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012275.2-381s21c1
Sequence:CCGGCAGGAGCCGACTCTAACACTACTCGAGTAGTGTTAGAGTCGGCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012275.2-925s21c1
Sequence:CCGGGGGAATCATTCCTGCTTAATGCTCGAGCATTAAGCAGGAATGATTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)