EMAIL THIS PAGE TO A FRIEND

IL3

interleukin 3 (colony-stimulating factor, multiple)

103 Gene Product Result for
Synonyms: IL-3 MCGF MULTI-CSF
UniProtKB ID: P08700, Q6GS87
Gene ID:
Human(3562) Summary: The protein encoded by this gene is a potent growth promoting cytokine. This cytokine is capable of supporting the proliferation of a broad range of hematopoietic cell types. It is involved in a variety of cell activities such as cell growth, differentiation and apoptosis. This cytokine has been shown to also possess neurotrophic activity, and it may be associated with neurologic disorders. [provided by RefSeq, Jul 2008]
Mouse(16187) interleukin 3
Rat(24495) interleukin 3
chicken(474356) interleukin 3
dog(481497) interleukin 3 (colony-stimulating factor, multiple)
domestic cat(101083903) interleukin 3 (colony-stimulating factor, multiple)
cow(280823) interleukin 3 (colony-stimulating factor, multiple)
sheep(443438) interleukin 3 (colony-stimulating factor, multiple)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0295 Mouse IL-3 ELISA Kit for serum, plasma and cell culture supernatant mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010556 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010556 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010556 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000588 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000588 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000588 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000588 Rosetta Predictions human pricing
NM_031513 Rosetta Predictions rat pricing
NM_010556 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000588 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062406 predicted 382
2 SASI_Hs01_00062407 predicted 477
3 SASI_Hs01_00062408 predicted 483
4 SASI_Hs01_00062409 predicted 271
5 SASI_Hs01_00062410 predicted 428
6 SASI_Hs01_00062411 predicted 481
7 SASI_Hs01_00062412 predicted 282
8 SASI_Hs01_00062414 predicted 312
9 SASI_Hs01_00062415 predicted 456
10 SASI_Hs02_00302858 predicted 427
11 SASI_Hs01_00062413 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031513 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114619 predicted 280
2 SASI_Rn01_00114620 predicted 311
3 SASI_Rn01_00114621 predicted 255
4 SASI_Rn01_00114622 predicted 330
5 SASI_Rn01_00114623 predicted 284
6 SASI_Rn01_00114624 predicted 261
7 SASI_Rn01_00114625 predicted 323
8 SASI_Rn01_00114627 predicted 313
9 SASI_Rn01_00114628 predicted 307
10 SASI_Rn02_00264639 predicted 204
11 SASI_Rn01_00114626 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010556 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065273 predicted 340
2 SASI_Mm01_00065274 predicted 244
3 SASI_Mm02_00318821 predicted 428
4 SASI_Mm02_00318822 predicted 441
5 SASI_Mm01_00065275 predicted 331
6 SASI_Mm02_00318823 predicted 454
7 SASI_Mm02_00318824 predicted 419
8 SASI_Mm01_00065277 predicted 289
9 SASI_Mm01_00065279 predicted 302
10 SASI_Mm01_00065280 predicted 302
11 SASI_Mm01_00065271 predicted 314
12 SASI_Mm01_00065272 predicted 321
13 SASI_Mm01_00065276 predicted 415
14 SASI_Mm01_00065278 predicted 218
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010556
IL3 MISSION shRNA Bacterial Glycerol Stock
interleukin 3 (colony-stimulating factor, multiple)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010556.4-221s21c1
Sequence:CCGGAGGACCCTCTCTGAGGAATAACTCGAGTTATTCCTCAGAGAGGGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010556.4-605s21c1
Sequence:CCGGCCATCAAATGTCTTATCAATTCTCGAGAATTGATAAGACATTTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010556.4-296s21c1
Sequence:CCGGTCCTGAGGACAGATACGTTATCTCGAGATAACGTATCTGTCCTCAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010556.2-397s1c1
Sequence:CCGGCTGGATGACTTTCGGAAGAAACTCGAGTTTCTTCCGAAAGTCATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010556.2-247s1c1
Sequence:CCGGCGGAGAGTAAACCTGTCCAAACTCGAGTTTGGACAGGTTTACTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010556.2-158s1c1
Sequence:CCGGGCTCTATTGTCAAGGAGATTACTCGAGTAATCTCCTTGACAATAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010556.2-129s1c1
Sequence:CCGGCCACCGTTTAACCAGAACGTTCTCGAGAACGTTCTGGTTAAACGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010556.2-317s1c1
Sequence:CCGGAGTCCAATCTTCAGAAACTTACTCGAGTAAGTTTCTGAAGATTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010556
IL3 MISSION shRNA shRNA Plasmid DNA
interleukin 3 (colony-stimulating factor, multiple)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010556.4-221s21c1
Sequence:CCGGAGGACCCTCTCTGAGGAATAACTCGAGTTATTCCTCAGAGAGGGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010556.4-605s21c1
Sequence:CCGGCCATCAAATGTCTTATCAATTCTCGAGAATTGATAAGACATTTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010556.4-296s21c1
Sequence:CCGGTCCTGAGGACAGATACGTTATCTCGAGATAACGTATCTGTCCTCAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010556.2-397s1c1
Sequence:CCGGCTGGATGACTTTCGGAAGAAACTCGAGTTTCTTCCGAAAGTCATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010556.2-247s1c1
Sequence:CCGGCGGAGAGTAAACCTGTCCAAACTCGAGTTTGGACAGGTTTACTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010556.2-158s1c1
Sequence:CCGGGCTCTATTGTCAAGGAGATTACTCGAGTAATCTCCTTGACAATAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010556.2-129s1c1
Sequence:CCGGCCACCGTTTAACCAGAACGTTCTCGAGAACGTTCTGGTTAAACGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010556.2-317s1c1
Sequence:CCGGAGTCCAATCTTCAGAAACTTACTCGAGTAAGTTTCTGAAGATTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010556
IL3 MISSION shRNA Lentiviral Transduction Particles
interleukin 3 (colony-stimulating factor, multiple)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010556.4-221s21c1
Sequence:CCGGAGGACCCTCTCTGAGGAATAACTCGAGTTATTCCTCAGAGAGGGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010556.4-605s21c1
Sequence:CCGGCCATCAAATGTCTTATCAATTCTCGAGAATTGATAAGACATTTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010556.4-296s21c1
Sequence:CCGGTCCTGAGGACAGATACGTTATCTCGAGATAACGTATCTGTCCTCAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010556.2-397s1c1
Sequence:CCGGCTGGATGACTTTCGGAAGAAACTCGAGTTTCTTCCGAAAGTCATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010556.2-247s1c1
Sequence:CCGGCGGAGAGTAAACCTGTCCAAACTCGAGTTTGGACAGGTTTACTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010556.2-158s1c1
Sequence:CCGGGCTCTATTGTCAAGGAGATTACTCGAGTAATCTCCTTGACAATAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010556.2-129s1c1
Sequence:CCGGCCACCGTTTAACCAGAACGTTCTCGAGAACGTTCTGGTTAAACGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010556.2-317s1c1
Sequence:CCGGAGTCCAATCTTCAGAAACTTACTCGAGTAAGTTTCTGAAGATTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000588
IL3 MISSION shRNA Bacterial Glycerol Stock
interleukin 3 (colony-stimulating factor, multiple)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000588.3-327s21c1
Sequence:CCGGGCAATTGAGAGCATTCTTAAACTCGAGTTTAAGAATGCTCTCAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000588.3-643s21c1
Sequence:CCGGCGGCATCAGATGAATTGTTAACTCGAGTTAACAATTCATCTGATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000588.3-723s21c1
Sequence:CCGGTTATCCCATTGAGACTATTTACTCGAGTAAATAGTCTCAATGGGATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000588.3-134s1c1
Sequence:CCGGCTTGAAGACAAGCTGGGTTAACTCGAGTTAACCCAGCTTGTCTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000588.3-240s1c1
Sequence:CCGGGACCAAGACATTCTGATGGAACTCGAGTTCCATCAGAATGTCTTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000588.3-472s1c1
Sequence:CCGGCGCAGGCTCAACAGACGACTTCTCGAGAAGTCGTCTGTTGAGCCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000588.3-157s1c1
Sequence:CCGGGCTCTAACATGATCGATGAAACTCGAGTTTCATCGATCATGTTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000588.3-389s1c1
Sequence:CCGGGCGACATCCAATCCATATCAACTCGAGTTGATATGGATTGGATGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000588
IL3 MISSION shRNA shRNA Plasmid DNA
interleukin 3 (colony-stimulating factor, multiple)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000588.3-327s21c1
Sequence:CCGGGCAATTGAGAGCATTCTTAAACTCGAGTTTAAGAATGCTCTCAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000588.3-643s21c1
Sequence:CCGGCGGCATCAGATGAATTGTTAACTCGAGTTAACAATTCATCTGATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000588.3-723s21c1
Sequence:CCGGTTATCCCATTGAGACTATTTACTCGAGTAAATAGTCTCAATGGGATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000588.3-134s1c1
Sequence:CCGGCTTGAAGACAAGCTGGGTTAACTCGAGTTAACCCAGCTTGTCTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000588.3-240s1c1
Sequence:CCGGGACCAAGACATTCTGATGGAACTCGAGTTCCATCAGAATGTCTTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000588.3-472s1c1
Sequence:CCGGCGCAGGCTCAACAGACGACTTCTCGAGAAGTCGTCTGTTGAGCCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000588.3-157s1c1
Sequence:CCGGGCTCTAACATGATCGATGAAACTCGAGTTTCATCGATCATGTTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000588.3-389s1c1
Sequence:CCGGGCGACATCCAATCCATATCAACTCGAGTTGATATGGATTGGATGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000588
IL3 MISSION shRNA Lentiviral Transduction Particles
interleukin 3 (colony-stimulating factor, multiple)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000588.3-327s21c1
Sequence:CCGGGCAATTGAGAGCATTCTTAAACTCGAGTTTAAGAATGCTCTCAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000588.3-643s21c1
Sequence:CCGGCGGCATCAGATGAATTGTTAACTCGAGTTAACAATTCATCTGATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000588.3-723s21c1
Sequence:CCGGTTATCCCATTGAGACTATTTACTCGAGTAAATAGTCTCAATGGGATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000588.3-134s1c1
Sequence:CCGGCTTGAAGACAAGCTGGGTTAACTCGAGTTAACCCAGCTTGTCTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000588.3-240s1c1
Sequence:CCGGGACCAAGACATTCTGATGGAACTCGAGTTCCATCAGAATGTCTTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000588.3-472s1c1
Sequence:CCGGCGCAGGCTCAACAGACGACTTCTCGAGAAGTCGTCTGTTGAGCCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000588.3-157s1c1
Sequence:CCGGGCTCTAACATGATCGATGAAACTCGAGTTTCATCGATCATGTTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000588.3-389s1c1
Sequence:CCGGGCGACATCCAATCCATATCAACTCGAGTTGATATGGATTGGATGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)