EMAIL THIS PAGE TO A FRIEND

IL3RA

interleukin 3 receptor, alpha (low affinity)

58 Gene Product Result for
Synonyms: CD123 IL3R IL3RAY IL3RX IL3RY hIL-3Ra
UniProtKB ID: P26951, A8K3F3, B9VI81, Q5HYQ7
Gene ID:
Human(3563) Summary: The protein encoded by this gene is an interleukin 3 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL3 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL3. This gene and the gene encoding the colony stimulating factor 2 receptor alpha chain (CSF2RA) form a cytokine receptor gene cluster in a X-Y pseudoautosomal region on chromosomes X or Y. Alternatively spliced transcript variants encoding distinct isoforms have been found. [provided by RefSeq, Jun 2012]
Mouse(16188) interleukin 3 receptor, alpha chain
Rat(246144) interleukin 3 receptor, alpha
sheep(101113991) interleukin 3 receptor, alpha (low affinity)
naked mole-rat(101696721) interleukin 3 receptor, alpha (low affinity)
cow(100299249) interleukin 3 receptor, alpha (low affinity)
dog(609293) interleukin 3 receptor, alpha (low affinity)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0700 Human IL3RA / Interleukin-3 Receptor Subunit Alpha ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002183 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002183 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002183 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008369 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008369 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008369 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002183 Rosetta Predictions human pricing
NM_139260 Rosetta Predictions rat pricing
NM_008369 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333399 predicted 1325
2 SASI_Hs01_00097216 predicted 424
3 SASI_Hs02_00333400 predicted 679
4 SASI_Hs01_00097217 predicted 496
5 SASI_Hs01_00097218 predicted 488
6 SASI_Hs01_00097219 predicted 931
7 SASI_Hs01_00097220 predicted 1030
8 SASI_Hs01_00097221 predicted 1142
9 SASI_Hs01_00097222 predicted 1050
10 SASI_Hs01_00097223 predicted 1127
11 SASI_Hs01_00097224 predicted 828
12 SASI_Hs01_00097225 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139260 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088142 predicted 496
2 SASI_Rn01_00088143 predicted 482
3 SASI_Rn01_00088144 predicted 325
4 SASI_Rn01_00088145 predicted 504
5 SASI_Rn01_00088146 predicted 385
6 SASI_Rn01_00088147 predicted 445
7 SASI_Rn02_00268552 predicted 493
8 SASI_Rn01_00088149 predicted 380
9 SASI_Rn01_00088150 predicted 203
10 SASI_Rn01_00088151 predicted 495
11 SASI_Rn01_00088148 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008369 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175916 predicted 1106
2 SASI_Mm01_00175917 predicted 692
3 SASI_Mm01_00175918 predicted 563
4 SASI_Mm01_00175919 predicted 625
5 SASI_Mm01_00175920 predicted 1029
6 SASI_Mm01_00175921 predicted 854
7 SASI_Mm01_00175922 predicted 934
8 SASI_Mm01_00175923 predicted 964
9 SASI_Mm01_00175924 predicted 629
10 SASI_Mm01_00175925 predicted 875
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002183
IL3RA MISSION shRNA Bacterial Glycerol Stock
interleukin 3 receptor, alpha (low affinity)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002183.2-865s21c1
Sequence:CCGGACTCTCCAGCGGTTCTCAAAGCTCGAGCTTTGAGAACCGCTGGAGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002183.2-1035s21c1
Sequence:CCGGGAAGTCATTTCAATCGCAAATCTCGAGATTTGCGATTGAAATGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002183.2-830s21c1
Sequence:CCGGACACGTATCGGGTGTCGTTTCCTCGAGGAAACGACACCCGATACGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002183.2-1170s1c1
Sequence:CCGGCCCGGGAAAGAGTGTATGAATCTCGAGATTCATACACTCTTTCCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002183.2-785s1c1
Sequence:CCGGCGTCAACAGTACGAGTGTCTTCTCGAGAAGACACTCGTACTGTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002183.2-400s1c1
Sequence:CCGGGCAAACGAAGGAAGATCCAAACTCGAGTTTGGATCTTCCTTCGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002183.2-1142s1c1
Sequence:CCGGCCTGGAACGTACACAGTACAACTCGAGTTGTACTGTGTACGTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002183.2-1059s1c1
Sequence:CCGGGCTATGAGCTTCAGATACAAACTCGAGTTTGTATCTGAAGCTCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002183.2-986s21c1
Sequence:CCGGATGACTGCAAAGTGTAATAAGCTCGAGCTTATTACACTTTGCAGTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002183
IL3RA MISSION shRNA shRNA Plasmid DNA
interleukin 3 receptor, alpha (low affinity)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002183.2-865s21c1
Sequence:CCGGACTCTCCAGCGGTTCTCAAAGCTCGAGCTTTGAGAACCGCTGGAGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002183.2-1035s21c1
Sequence:CCGGGAAGTCATTTCAATCGCAAATCTCGAGATTTGCGATTGAAATGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002183.2-830s21c1
Sequence:CCGGACACGTATCGGGTGTCGTTTCCTCGAGGAAACGACACCCGATACGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002183.2-1170s1c1
Sequence:CCGGCCCGGGAAAGAGTGTATGAATCTCGAGATTCATACACTCTTTCCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002183.2-785s1c1
Sequence:CCGGCGTCAACAGTACGAGTGTCTTCTCGAGAAGACACTCGTACTGTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002183.2-400s1c1
Sequence:CCGGGCAAACGAAGGAAGATCCAAACTCGAGTTTGGATCTTCCTTCGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002183.2-1142s1c1
Sequence:CCGGCCTGGAACGTACACAGTACAACTCGAGTTGTACTGTGTACGTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002183.2-1059s1c1
Sequence:CCGGGCTATGAGCTTCAGATACAAACTCGAGTTTGTATCTGAAGCTCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002183.2-986s21c1
Sequence:CCGGATGACTGCAAAGTGTAATAAGCTCGAGCTTATTACACTTTGCAGTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002183
IL3RA MISSION shRNA Lentiviral Transduction Particles
interleukin 3 receptor, alpha (low affinity)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002183.2-865s21c1
Sequence:CCGGACTCTCCAGCGGTTCTCAAAGCTCGAGCTTTGAGAACCGCTGGAGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002183.2-1035s21c1
Sequence:CCGGGAAGTCATTTCAATCGCAAATCTCGAGATTTGCGATTGAAATGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002183.2-830s21c1
Sequence:CCGGACACGTATCGGGTGTCGTTTCCTCGAGGAAACGACACCCGATACGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002183.2-1170s1c1
Sequence:CCGGCCCGGGAAAGAGTGTATGAATCTCGAGATTCATACACTCTTTCCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002183.2-785s1c1
Sequence:CCGGCGTCAACAGTACGAGTGTCTTCTCGAGAAGACACTCGTACTGTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002183.2-400s1c1
Sequence:CCGGGCAAACGAAGGAAGATCCAAACTCGAGTTTGGATCTTCCTTCGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002183.2-1142s1c1
Sequence:CCGGCCTGGAACGTACACAGTACAACTCGAGTTGTACTGTGTACGTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002183.2-1059s1c1
Sequence:CCGGGCTATGAGCTTCAGATACAAACTCGAGTTTGTATCTGAAGCTCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002183.2-986s21c1
Sequence:CCGGATGACTGCAAAGTGTAATAAGCTCGAGCTTATTACACTTTGCAGTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008369
VALIDATED
IL3RA MISSION shRNA Bacterial Glycerol Stock
interleukin 3 receptor, alpha (low affinity)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000068149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008369.1-1042s1c1
Sequence:CCGGCAAGTCGAGGTCAGAGGTTTACTCGAGTAAACCTCTGACCTCGACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008369.1-905s1c1
Sequence:CCGGGCGCGGAACAGATTCCACCATCTCGAGATGGTGGAATCTGTTCCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008369.1-235s1c1
Sequence:CCGGGCCCATCCAGAACCTGCATATCTCGAGATATGCAGGTTCTGGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008369.1-403s1c1
Sequence:CCGGTGTGACCAACTTCACCGTCTTCTCGAGAAGACGGTGAAGTTGGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008369
VALIDATED
IL3RA MISSION shRNA shRNA Plasmid DNA
interleukin 3 receptor, alpha (low affinity)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000068149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008369.1-1042s1c1
Sequence:CCGGCAAGTCGAGGTCAGAGGTTTACTCGAGTAAACCTCTGACCTCGACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008369.1-905s1c1
Sequence:CCGGGCGCGGAACAGATTCCACCATCTCGAGATGGTGGAATCTGTTCCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008369.1-235s1c1
Sequence:CCGGGCCCATCCAGAACCTGCATATCTCGAGATATGCAGGTTCTGGATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008369.1-403s1c1
Sequence:CCGGTGTGACCAACTTCACCGTCTTCTCGAGAAGACGGTGAAGTTGGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008369
VALIDATED
IL3RA MISSION shRNA Lentiviral Transduction Particles
interleukin 3 receptor, alpha (low affinity)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000068149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008369.1-1042s1c1
Sequence:CCGGCAAGTCGAGGTCAGAGGTTTACTCGAGTAAACCTCTGACCTCGACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008369.1-905s1c1
Sequence:CCGGGCGCGGAACAGATTCCACCATCTCGAGATGGTGGAATCTGTTCCGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008369.1-235s1c1
Sequence:CCGGGCCCATCCAGAACCTGCATATCTCGAGATATGCAGGTTCTGGATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008369.1-403s1c1
Sequence:CCGGTGTGACCAACTTCACCGTCTTCTCGAGAAGACGGTGAAGTTGGTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)