EMAIL THIS PAGE TO A FRIEND

IL4

interleukin 4

117 Gene Product Result for
Synonyms: BCGF-1 BCGF1 BSF-1 BSF1 IL-4
UniProtKB ID: P05112, Q14630
Gene ID:
Human(3565) Summary: The protein encoded by this gene is a pleiotropic cytokine produced by activated T cells. This cytokine is a ligand for interleukin 4 receptor. The interleukin 4 receptor also binds to IL13, which may contribute to many overlapping functions of this cytokine and IL13. STAT6, a signal transducer and activator of transcription, has been shown to play a central role in mediating the immune regulatory signal of this cytokine. This gene, IL3, IL5, IL13, and CSF2 form a cytokine gene cluster on chromosome 5q, with this gene particularly close to IL13. This gene, IL13 and IL5 are found to be regulated coordinately by several long-range regulatory elements in an over 120 kilobase range on the chromosome. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(16189) interleukin 4
Rat(287287) interleukin 4
Zebrafish(100188894) interleukin 4
chicken(416330) interleukin 4
cow(280824) interleukin 4
Horse(100034225) interleukin 4
domestic cat(751514) interleukin 4
dog(403785) interleukin 4
Goat(100860814) interleukin 4
sheep(443327) interleukin 4
sheep(101122781) interleukin 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV54329 Anti-IL4 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2103750 Anti-IL4 antibody produced in rabbit affinity isolated antibody human
western blot pricing
I7776 Anti-Interleukin-4 antibody produced in goat affinity isolated antibody, lyophilized powder mouse
neutralization, western blot pricing
I7526 Anti-Interleukin-4 antibody produced in goat affinity isolated antibody, lyophilized powder human
ELISA, neutralization, western blot pricing
I8784 Anti-Interleukin-4 antibody produced in goat IgG fraction of antiserum, lyophilized powder human
neutralization, western blot pricing
H0665 Monoclonal Anti-Hepatocyte Growth Factor antibody produced in mouse clone 24516, purified immunoglobulin, lyophilized powder human
ELISA, western blot pricing
SAB1402819 Monoclonal Anti-IL4, (C-terminal) antibody produced in mouse clone 3D11, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
I7651 Monoclonal Anti-Interleukin-4 antibody produced in mouse clone 34019.111, purified immunoglobulin, lyophilized powder human
ELISA, neutralization, western blot pricing
I7034 Monoclonal Anti-Interleukin-4 antibody produced in mouse clone 3007, purified immunoglobulin, lyophilized powder human
immunohistochemistry, neutralization, western blot pricing
I7159 Monoclonal Anti-Interleukin-4 antibody produced in mouse clone 3010, purified immunoglobulin, lyophilized powder human
ELISA, western blot pricing
F3901 Monoclonal Anti-Interleukin-4−Carboxyfluorescein antibody produced in mouse clone 3007.11, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
P7097 Monoclonal Anti-Interleukin-4−R-Phycoerythrin antibody produced in mouse clone 3007.11, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000589 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000589 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000589 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021283 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021283 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021283 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000589 Rosetta Predictions human pricing
NM_172348 Rosetta Predictions human pricing
NM_201270 Rosetta Predictions rat pricing
NM_021283 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114299 predicted 819
2 SASI_Hs01_00114300 predicted 444
3 SASI_Hs01_00114301 predicted 746
4 SASI_Hs01_00114302 predicted 473
5 SASI_Hs01_00114303 predicted 584
6 SASI_Hs01_00114304 predicted 539
7 SASI_Hs01_00114305 predicted 553
8 SASI_Hs02_00302859 predicted 664
9 SASI_Hs01_00114306 predicted 422
10 SASI_Hs01_00114307 predicted 586
11 SASI_Hs01_00114308 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041237 predicted 762
2 SASI_Hs01_00041238 predicted 449
3 SASI_Hs01_00041239 predicted 698
4 SASI_Hs01_00041240 predicted 536
5 SASI_Hs01_00041241 predicted 455
6 SASI_Hs01_00041242 predicted 501
7 SASI_Hs02_00367995 predicted 616
8 SASI_Hs01_00041243 predicted 423
9 SASI_Hs01_00041244 predicted 531
10 SASI_Hs01_00041245 predicted 475
11 SASI_Hs01_00041246 predicted 708
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201270 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081545 predicted 238
2 SASI_Rn01_00081546 predicted 238
3 SASI_Rn01_00081547 predicted 231
4 SASI_Rn01_00081548 predicted 213
5 SASI_Rn01_00081549 predicted 210
6 SASI_Rn01_00081550 predicted 243
7 SASI_Rn01_00081551 predicted 242
8 SASI_Rn01_00081552 predicted 233
9 SASI_Rn02_00270297 predicted 340
10 SASI_Rn01_00081554 predicted 169
11 SASI_Rn01_00081553 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021283 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114054 predicted 293
2 SASI_Mm01_00114055 predicted 273
3 SASI_Mm01_00114056 predicted 301
4 SASI_Mm01_00114057 predicted 229
5 SASI_Mm01_00114058 predicted 272
6 SASI_Mm01_00114059 predicted 235
7 SASI_Mm01_00114060 predicted 294
8 SASI_Mm01_00114061 predicted 301
9 SASI_Mm01_00114062 predicted 248
10 SASI_Mm01_00114063 predicted 273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000589
IL4 MISSION shRNA Bacterial Glycerol Stock
interleukin 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000589.2-675s21c1
Sequence:CCGGAGCTGATCCGATTCCTGAAACCTCGAGGTTTCAGGAATCGGATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000589.2-458s21c1
Sequence:CCGGACCTTACAGGAGATCATCAAACTCGAGTTTGATGATCTCCTGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000589.2-414s21c1
Sequence:CCGGTAGCATGTGCCGGCAACTTTGCTCGAGCAAAGTTGCCGGCACATGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000589.2-520s1c1
Sequence:CCGGGTTGACCGTAACAGACATCTTCTCGAGAAGATGTCTGTTACGGTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000589.2-599s1c1
Sequence:CCGGCGGCAGTTCTACAGCCACCATCTCGAGATGGTGGCTGTAGAACTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000589.2-552s1c1
Sequence:CCGGAGAACACAACTGAGAAGGAAACTCGAGTTTCCTTCTCAGTTGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000589.2-722s1c1
Sequence:CCGGGCGGGCTTGAATTCCTGTCCTCTCGAGAGGACAGGAATTCAAGCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000589.2-436s1c1
Sequence:CCGGCCACGGACACAAGTGCGATATCTCGAGATATCGCACTTGTGTCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000589
IL4 MISSION shRNA shRNA Plasmid DNA
interleukin 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000589.2-675s21c1
Sequence:CCGGAGCTGATCCGATTCCTGAAACCTCGAGGTTTCAGGAATCGGATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000589.2-458s21c1
Sequence:CCGGACCTTACAGGAGATCATCAAACTCGAGTTTGATGATCTCCTGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000589.2-414s21c1
Sequence:CCGGTAGCATGTGCCGGCAACTTTGCTCGAGCAAAGTTGCCGGCACATGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000589.2-520s1c1
Sequence:CCGGGTTGACCGTAACAGACATCTTCTCGAGAAGATGTCTGTTACGGTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000589.2-599s1c1
Sequence:CCGGCGGCAGTTCTACAGCCACCATCTCGAGATGGTGGCTGTAGAACTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000589.2-552s1c1
Sequence:CCGGAGAACACAACTGAGAAGGAAACTCGAGTTTCCTTCTCAGTTGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000589.2-722s1c1
Sequence:CCGGGCGGGCTTGAATTCCTGTCCTCTCGAGAGGACAGGAATTCAAGCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000589.2-436s1c1
Sequence:CCGGCCACGGACACAAGTGCGATATCTCGAGATATCGCACTTGTGTCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000589
IL4 MISSION shRNA Lentiviral Transduction Particles
interleukin 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000589.2-675s21c1
Sequence:CCGGAGCTGATCCGATTCCTGAAACCTCGAGGTTTCAGGAATCGGATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000589.2-458s21c1
Sequence:CCGGACCTTACAGGAGATCATCAAACTCGAGTTTGATGATCTCCTGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000589.2-414s21c1
Sequence:CCGGTAGCATGTGCCGGCAACTTTGCTCGAGCAAAGTTGCCGGCACATGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000589.2-520s1c1
Sequence:CCGGGTTGACCGTAACAGACATCTTCTCGAGAAGATGTCTGTTACGGTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000589.2-599s1c1
Sequence:CCGGCGGCAGTTCTACAGCCACCATCTCGAGATGGTGGCTGTAGAACTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000589.2-552s1c1
Sequence:CCGGAGAACACAACTGAGAAGGAAACTCGAGTTTCCTTCTCAGTTGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000589.2-722s1c1
Sequence:CCGGGCGGGCTTGAATTCCTGTCCTCTCGAGAGGACAGGAATTCAAGCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000589.2-436s1c1
Sequence:CCGGCCACGGACACAAGTGCGATATCTCGAGATATCGCACTTGTGTCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021283
IL4 MISSION shRNA Bacterial Glycerol Stock
interleukin 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021283.1-354s1c1
Sequence:CCGGGAAGAACTCTAGTGTTCTCATCTCGAGATGAGAACACTAGAGTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021283.1-119s1c1
Sequence:CCGGTGCTCTTCTTTCTCGAATGTACTCGAGTACATTCGAGAAAGAAGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021283.1-403s1c1
Sequence:CCGGCGATGCCTGGATTCATCGATACTCGAGTATCGATGAATCCAGGCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021283.1-298s1c1
Sequence:CCGGGCTTCCAAGGTGCTTCGCATACTCGAGTATGCGAAGCACCTTGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021283.1-428s1c1
Sequence:CCGGGCACCATGAATGAGTCCAAGTCTCGAGACTTGGACTCATTCATGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021283
IL4 MISSION shRNA shRNA Plasmid DNA
interleukin 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021283.1-354s1c1
Sequence:CCGGGAAGAACTCTAGTGTTCTCATCTCGAGATGAGAACACTAGAGTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021283.1-119s1c1
Sequence:CCGGTGCTCTTCTTTCTCGAATGTACTCGAGTACATTCGAGAAAGAAGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021283.1-403s1c1
Sequence:CCGGCGATGCCTGGATTCATCGATACTCGAGTATCGATGAATCCAGGCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021283.1-298s1c1
Sequence:CCGGGCTTCCAAGGTGCTTCGCATACTCGAGTATGCGAAGCACCTTGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021283.1-428s1c1
Sequence:CCGGGCACCATGAATGAGTCCAAGTCTCGAGACTTGGACTCATTCATGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021283
IL4 MISSION shRNA Lentiviral Transduction Particles
interleukin 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021283.1-354s1c1
Sequence:CCGGGAAGAACTCTAGTGTTCTCATCTCGAGATGAGAACACTAGAGTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021283.1-119s1c1
Sequence:CCGGTGCTCTTCTTTCTCGAATGTACTCGAGTACATTCGAGAAAGAAGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021283.1-403s1c1
Sequence:CCGGCGATGCCTGGATTCATCGATACTCGAGTATCGATGAATCCAGGCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021283.1-298s1c1
Sequence:CCGGGCTTCCAAGGTGCTTCGCATACTCGAGTATGCGAAGCACCTTGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021283.1-428s1c1
Sequence:CCGGGCACCATGAATGAGTCCAAGTCTCGAGACTTGGACTCATTCATGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)