EMAIL THIS PAGE TO A FRIEND

IL4I1

interleukin 4 induced 1

100 Gene Product Result for
Synonyms: FIG1 LAAO LAO
Gene ID:
Human(259307) Summary: This gene encodes a protein with limited similarity to L-amino acid oxidase which contains the conserved amino acids thought to be involved in catalysis and binding of flavin adenine dinucleotide (FAD) cofactor. The expression of this gene can be induced by interleukin 4 in B cells, however, expression of transcripts containing the first two exons of the upstream gene is found in other cell types. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(14204) interleukin 4 induced 1
Rat(308575) interleukin 4 induced 1
sheep(101114462) interleukin 4 induced 1
domestic guinea pig(100722053) interleukin 4 induced 1
naked mole-rat(101710424) interleukin 4 induced 1
chicken(417039) interleukin 4 induced 1
cow(100138517) interleukin 4 induced 1
domestic cat(101100683) interleukin 4 induced 1
dog(484371) interleukin 4 induced 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA045598 Anti-IL4I1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152899 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152899 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152899 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010215 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010215 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010215 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152899 Rosetta Predictions human pricing
NM_172374 Rosetta Predictions human pricing
XM_218621 Rosetta Predictions rat pricing
NM_010215 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077908 predicted 330
2 SASI_Hs01_00077910 predicted 430
3 SASI_Hs01_00077911 predicted 628
4 SASI_Hs01_00077912 predicted 478
5 SASI_Hs01_00077913 predicted 1488
6 SASI_Hs01_00077914 predicted 1177
7 SASI_Hs01_00077915 predicted 610
8 SASI_Hs01_00077916 predicted 1491
9 SASI_Hs01_00077917 predicted 519
10 SASI_Hs02_00366865 predicted 781
11 SASI_Hs01_00077909 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143320 predicted 845
2 SASI_Hs01_00143322 predicted 950
3 SASI_Hs01_00143323 predicted 1150
4 SASI_Hs01_00143324 predicted 997
5 SASI_Hs01_00143325 predicted 1996
6 SASI_Hs01_00143326 predicted 1689
7 SASI_Hs01_00143327 predicted 1126
8 SASI_Hs01_00143328 predicted 2006
9 SASI_Hs01_00143329 predicted 1037
10 SASI_Hs02_00368027 predicted 1291
11 SASI_Hs01_00143321 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218621 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00142221 predicted 1421
2 SASI_Rn01_00142222 predicted 596
3 SASI_Rn01_00142223 predicted 605
4 SASI_Rn01_00142224 predicted 393
5 SASI_Rn01_00142225 predicted 445
6 SASI_Rn01_00142226 predicted 253
7 SASI_Rn01_00142227 predicted 751
8 SASI_Rn01_00142228 predicted 1079
9 SASI_Rn01_00142229 predicted 418
10 SASI_Rn01_00142230 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010215 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160168 predicted 644
2 SASI_Mm01_00160169 predicted 440
3 SASI_Mm01_00160170 predicted 1379
4 SASI_Mm01_00160171 predicted 401
5 SASI_Mm01_00160172 predicted 649
6 SASI_Mm01_00160173 predicted 660
7 SASI_Mm01_00160174 predicted 1464
8 SASI_Mm01_00160175 predicted 300
9 SASI_Mm01_00160176 predicted 290
10 SASI_Mm01_00160177 predicted 930
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152899
IL4I1 MISSION shRNA Bacterial Glycerol Stock
interleukin 4 induced 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152899.1-703s1c1
Sequence:CCGGCACACGCTCTTGGAATATCTTCTCGAGAAGATATTCCAAGAGCGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152899.1-540s1c1
Sequence:CCGGGCGCAACTATGTGGTGGAGAACTCGAGTTCTCCACCACATAGTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152899.1-1130s1c1
Sequence:CCGGCGGCCACCAAGGTGTTCCTAACTCGAGTTAGGAACACCTTGGTGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152899.1-489s1c1
Sequence:CCGGGTTCACCCAGTACGACAAGAACTCGAGTTCTTGTCGTACTGGGTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152899.1-612s1c1
Sequence:CCGGGCCCGAAGACATCTACCAGATCTCGAGATCTGGTAGATGTCTTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152899.1-1493s21c1
Sequence:CCGGCTTATGGCCGCATCTACTTTGCTCGAGCAAAGTAGATGCGGCCATAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152899.1-185s21c1
Sequence:CCGGGCATGCAGGATCCTGACTATGCTCGAGCATAGTCAGGATCCTGCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152899.1-700s21c1
Sequence:CCGGAGGCACACGCTCTTGGAATATCTCGAGATATTCCAAGAGCGTGTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152899.1-779s21c1
Sequence:CCGGCCGAGGATGGCTTCTTCTATCCTCGAGGATAGAAGAAGCCATCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152899
IL4I1 MISSION shRNA shRNA Plasmid DNA
interleukin 4 induced 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152899.1-703s1c1
Sequence:CCGGCACACGCTCTTGGAATATCTTCTCGAGAAGATATTCCAAGAGCGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152899.1-540s1c1
Sequence:CCGGGCGCAACTATGTGGTGGAGAACTCGAGTTCTCCACCACATAGTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152899.1-1130s1c1
Sequence:CCGGCGGCCACCAAGGTGTTCCTAACTCGAGTTAGGAACACCTTGGTGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152899.1-489s1c1
Sequence:CCGGGTTCACCCAGTACGACAAGAACTCGAGTTCTTGTCGTACTGGGTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152899.1-612s1c1
Sequence:CCGGGCCCGAAGACATCTACCAGATCTCGAGATCTGGTAGATGTCTTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152899.1-1493s21c1
Sequence:CCGGCTTATGGCCGCATCTACTTTGCTCGAGCAAAGTAGATGCGGCCATAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152899.1-185s21c1
Sequence:CCGGGCATGCAGGATCCTGACTATGCTCGAGCATAGTCAGGATCCTGCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152899.1-700s21c1
Sequence:CCGGAGGCACACGCTCTTGGAATATCTCGAGATATTCCAAGAGCGTGTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152899.1-779s21c1
Sequence:CCGGCCGAGGATGGCTTCTTCTATCCTCGAGGATAGAAGAAGCCATCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152899
IL4I1 MISSION shRNA Lentiviral Transduction Particles
interleukin 4 induced 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152899.1-703s1c1
Sequence:CCGGCACACGCTCTTGGAATATCTTCTCGAGAAGATATTCCAAGAGCGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152899.1-540s1c1
Sequence:CCGGGCGCAACTATGTGGTGGAGAACTCGAGTTCTCCACCACATAGTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152899.1-1130s1c1
Sequence:CCGGCGGCCACCAAGGTGTTCCTAACTCGAGTTAGGAACACCTTGGTGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152899.1-489s1c1
Sequence:CCGGGTTCACCCAGTACGACAAGAACTCGAGTTCTTGTCGTACTGGGTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152899.1-612s1c1
Sequence:CCGGGCCCGAAGACATCTACCAGATCTCGAGATCTGGTAGATGTCTTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152899.1-1493s21c1
Sequence:CCGGCTTATGGCCGCATCTACTTTGCTCGAGCAAAGTAGATGCGGCCATAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152899.1-185s21c1
Sequence:CCGGGCATGCAGGATCCTGACTATGCTCGAGCATAGTCAGGATCCTGCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152899.1-700s21c1
Sequence:CCGGAGGCACACGCTCTTGGAATATCTCGAGATATTCCAAGAGCGTGTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152899.1-779s21c1
Sequence:CCGGCCGAGGATGGCTTCTTCTATCCTCGAGGATAGAAGAAGCCATCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010215
IL4I1 MISSION shRNA Bacterial Glycerol Stock
interleukin 4 induced 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010215.1-1617s1c1
Sequence:CCGGGCCAACTATCTGGACCAGTATCTCGAGATACTGGTCCAGATAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010215.1-1544s1c1
Sequence:CCGGCGCGGTGAGAATCAATAATAACTCGAGTTATTATTGATTCTCACCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010215.1-137s1c1
Sequence:CCGGGAACCCTATTGAGAAGTGTATCTCGAGATACACTTCTCAATAGGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010215.1-1825s1c1
Sequence:CCGGCCCACCAGAATATATATCCTTCTCGAGAAGGATATATATTCTGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010215.1-494s1c1
Sequence:CCGGGCATAATGTGAAGCTGCGAAACTCGAGTTTCGCAGCTTCACATTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010215
IL4I1 MISSION shRNA shRNA Plasmid DNA
interleukin 4 induced 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010215.1-1617s1c1
Sequence:CCGGGCCAACTATCTGGACCAGTATCTCGAGATACTGGTCCAGATAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010215.1-1544s1c1
Sequence:CCGGCGCGGTGAGAATCAATAATAACTCGAGTTATTATTGATTCTCACCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010215.1-137s1c1
Sequence:CCGGGAACCCTATTGAGAAGTGTATCTCGAGATACACTTCTCAATAGGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010215.1-1825s1c1
Sequence:CCGGCCCACCAGAATATATATCCTTCTCGAGAAGGATATATATTCTGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010215.1-494s1c1
Sequence:CCGGGCATAATGTGAAGCTGCGAAACTCGAGTTTCGCAGCTTCACATTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010215
IL4I1 MISSION shRNA Lentiviral Transduction Particles
interleukin 4 induced 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010215.1-1617s1c1
Sequence:CCGGGCCAACTATCTGGACCAGTATCTCGAGATACTGGTCCAGATAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010215.1-1544s1c1
Sequence:CCGGCGCGGTGAGAATCAATAATAACTCGAGTTATTATTGATTCTCACCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010215.1-137s1c1
Sequence:CCGGGAACCCTATTGAGAAGTGTATCTCGAGATACACTTCTCAATAGGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010215.1-1825s1c1
Sequence:CCGGCCCACCAGAATATATATCCTTCTCGAGAAGGATATATATTCTGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010215.1-494s1c1
Sequence:CCGGGCATAATGTGAAGCTGCGAAACTCGAGTTTCGCAGCTTCACATTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)