EMAIL THIS PAGE TO A FRIEND

IL4R

interleukin 4 receptor

95 Gene Product Result for
Synonyms: CD124 IL-4RA IL4RA
Gene ID:
Human(3566) Summary: This gene encodes the alpha chain of the interleukin-4 receptor, a type I transmembrane protein that can bind interleukin 4 and interleukin 13 to regulate IgE production. The encoded protein also can bind interleukin 4 to promote differentiation of Th2 cells. A soluble form of the encoded protein can be produced by proteolysis of the membrane-bound protein, and this soluble form can inhibit IL4-mediated cell proliferation and IL5 upregulation by T-cells. Allelic variations in this gene have been associated with atopy, a condition that can manifest itself as allergic rhinitis, sinusitus, asthma, or eczema. Polymorphisms in this gene are also associated with resistance to human immunodeficiency virus type-1 infection. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]
Rat(25084) interleukin 4 receptor
sheep(101109063) interleukin 4 receptor
Domestic Rabbit(100337721) interleukin 4 receptor
domestic guinea pig(100721566) interleukin 4 receptor
naked mole-rat(101704138) interleukin 4 receptor
Zebrafish(503594) interleukin 4 receptor
chicken(416585) interleukin 4 receptor
cow(404154) interleukin 4 receptor
Horse(791252) interleukin 4 receptor
domestic cat(101096277) interleukin 4 receptor
dog(489957) interleukin 4 receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000418 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000418 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000418 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027061 MISSION® esiRNA esiRNA human IL4R (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000418 Rosetta Predictions human pricing
NM_001008699 Rosetta Predictions human pricing
NM_133380 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219592 predicted 614
2 SASI_Hs01_00219593 predicted 493
3 SASI_Hs01_00219594 predicted 447
4 SASI_Hs02_00302517 predicted 509
5 SASI_Hs01_00219595 predicted 568
6 SASI_Hs01_00219596 predicted 514
7 SASI_Hs01_00219597 predicted 683
8 SASI_Hs01_00219598 predicted 481
9 SASI_Hs01_00219599 predicted 511
10 SASI_Hs01_00219600 predicted 593
11 SASI_Hs01_00219601 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184176 predicted 610
2 SASI_Hs01_00184177 predicted 498
3 SASI_Hs01_00184178 predicted 453
4 SASI_Hs02_00305532 predicted 518
5 SASI_Hs01_00184179 predicted 569
6 SASI_Hs01_00184180 predicted 513
7 SASI_Hs01_00184181 predicted 685
8 SASI_Hs01_00184182 predicted 488
9 SASI_Hs01_00184183 predicted 509
10 SASI_Hs01_00184184 predicted 590
11 SASI_Hs01_00184185 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133380 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120790 predicted 927
2 SASI_Rn02_00267635 predicted 673
3 SASI_Rn01_00120792 predicted 538
4 SASI_Rn02_00267636 predicted 917
5 SASI_Rn02_00267637 predicted 2023
6 SASI_Rn02_00267638 predicted 236
7 SASI_Rn02_00267639 predicted 511
8 SASI_Rn02_00267640 predicted 941
9 SASI_Rn02_00267641 predicted 313
10 SASI_Rn02_00267642 predicted 606
11 SASI_Rn01_00120789 predicted 688
12 SASI_Rn01_00120791 predicted 1068
13 SASI_Rn01_00120793 predicted 453
14 SASI_Rn01_00120794 predicted 1007
15 SASI_Rn01_00120795 predicted 1163
16 SASI_Rn01_00120796 predicted 1075
17 SASI_Rn01_00120797 predicted 587
18 SASI_Rn01_00120798 predicted 975
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000418
IL4R MISSION shRNA Bacterial Glycerol Stock
interleukin 4 receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000418.2-712s21c1
Sequence:CCGGTCACCTATGCAGTCAACATTTCTCGAGAAATGTTGACTGCATAGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000418.2-2748s21c1
Sequence:CCGGCAGATGAGGACTAGGGCTTATCTCGAGATAAGCCCTAGTCCTCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000418.2-520s21c1
Sequence:CCGGTGGTCAGTGCGGATAACTATACTCGAGTATAGTTATCCGCACTGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000418.1-619s1c1
Sequence:CCGGCCCTGACAATTACCTGTATAACTCGAGTTATACAGGTAATTGTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000418.1-998s1c1
Sequence:CCGGGTGGCTATAATAATCCAGGATCTCGAGATCCTGGATTATTATAGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000418.1-2632s1c1
Sequence:CCGGCACATACATGAGGGTCTCTTACTCGAGTAAGAGACCCTCATGTATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000418.1-2304s1c1
Sequence:CCGGGCATTGTCTACTCAGCCCTTACTCGAGTAAGGGCTGAGTAGACAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000418.1-679s1c1
Sequence:CCGGCCCGGCAGATTTCAGAATCTACTCGAGTAGATTCTGAAATCTGCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000418
IL4R MISSION shRNA shRNA Plasmid DNA
interleukin 4 receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000418.2-712s21c1
Sequence:CCGGTCACCTATGCAGTCAACATTTCTCGAGAAATGTTGACTGCATAGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000418.2-2748s21c1
Sequence:CCGGCAGATGAGGACTAGGGCTTATCTCGAGATAAGCCCTAGTCCTCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000418.2-520s21c1
Sequence:CCGGTGGTCAGTGCGGATAACTATACTCGAGTATAGTTATCCGCACTGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000418.1-619s1c1
Sequence:CCGGCCCTGACAATTACCTGTATAACTCGAGTTATACAGGTAATTGTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000418.1-998s1c1
Sequence:CCGGGTGGCTATAATAATCCAGGATCTCGAGATCCTGGATTATTATAGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000418.1-2632s1c1
Sequence:CCGGCACATACATGAGGGTCTCTTACTCGAGTAAGAGACCCTCATGTATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000418.1-2304s1c1
Sequence:CCGGGCATTGTCTACTCAGCCCTTACTCGAGTAAGGGCTGAGTAGACAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000418.1-679s1c1
Sequence:CCGGCCCGGCAGATTTCAGAATCTACTCGAGTAGATTCTGAAATCTGCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000418
IL4R MISSION shRNA Lentiviral Transduction Particles
interleukin 4 receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000418.2-712s21c1
Sequence:CCGGTCACCTATGCAGTCAACATTTCTCGAGAAATGTTGACTGCATAGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000418.2-2748s21c1
Sequence:CCGGCAGATGAGGACTAGGGCTTATCTCGAGATAAGCCCTAGTCCTCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000418.2-520s21c1
Sequence:CCGGTGGTCAGTGCGGATAACTATACTCGAGTATAGTTATCCGCACTGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000418.1-619s1c1
Sequence:CCGGCCCTGACAATTACCTGTATAACTCGAGTTATACAGGTAATTGTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000418.1-998s1c1
Sequence:CCGGGTGGCTATAATAATCCAGGATCTCGAGATCCTGGATTATTATAGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000418.1-2632s1c1
Sequence:CCGGCACATACATGAGGGTCTCTTACTCGAGTAAGAGACCCTCATGTATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000418.1-2304s1c1
Sequence:CCGGGCATTGTCTACTCAGCCCTTACTCGAGTAAGGGCTGAGTAGACAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000418.1-679s1c1
Sequence:CCGGCCCGGCAGATTTCAGAATCTACTCGAGTAGATTCTGAAATCTGCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)