EMAIL THIS PAGE TO A FRIEND

IL5

interleukin 5 (colony-stimulating factor, eosinophil)

96 Gene Product Result for
Synonyms: EDF IL-5 TRF
UniProtKB ID: P05113, Q13840
Gene ID:
Human(3567) Summary: This gene encodes a cytokine that acts as a growth and differentiation factor for both B cells and eosinophils. The encoded cytokine plays a major role in the regulation of eosinophil formation, maturation, recruitment and survival. The increased production of this cytokine may be related to pathogenesis of eosinophil-dependent inflammatory diseases. This cytokine functions by binding to its receptor, which is a heterodimer, whose beta subunit is shared with the receptors for interleukine 3 (IL3) and colony stimulating factor 2 (CSF2/GM-CSF). This gene is located on chromosome 5 within a cytokine gene cluster which includes interleukin 4 (IL4), interleukin 13 (IL13), and CSF2 . This gene, IL4, and IL13 may be regulated coordinately by long-range regulatory elements spread over 120 kilobases on chromosome 5q31. [provided by RefSeq, Jul 2013]
Mouse(16191) interleukin 5
Rat(24497) interleukin 5
sheep(443350) interleukin 5 (colony-stimulating factor, eosinophil)
naked mole-rat(101719528) interleukin 5 (colony-stimulating factor, eosinophil)
chicken(474360) interleukin 5 (colony-stimulating factor, eosinophil)
cow(280825) interleukin 5 (colony-stimulating factor, eosinophil)
Horse(100034199) interleukin 5 (colony-stimulating factor, eosinophil)
domestic cat(493803) interleukin 5 (colony-stimulating factor, eosinophil)
dog(403790) interleukin 5 (colony-stimulating factor, eosinophil)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010558 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010558 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010558 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000879 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000879 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000879 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU011811 MISSION® esiRNA esiRNA targeting mouse Il5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000879 Rosetta Predictions human pricing
NM_021834 Rosetta Predictions rat pricing
NM_010558 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000879 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225374 predicted 547
2 SASI_Hs01_00225375 predicted 552
3 SASI_Hs01_00225376 predicted 588
4 SASI_Hs01_00225378 predicted 586
5 SASI_Hs01_00225379 predicted 587
6 SASI_Hs01_00225380 predicted 584
7 SASI_Hs01_00225382 predicted 577
8 SASI_Hs01_00225377 predicted 557
9 SASI_Hs01_00225383 predicted 563
10 SASI_Hs02_00303418 predicted 564
11 SASI_Hs01_00225381 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021834 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088738 predicted 138
2 SASI_Rn01_00088740 predicted 346
3 SASI_Rn01_00088741 predicted 113
4 SASI_Rn01_00088742 predicted 238
5 SASI_Rn01_00088743 predicted 7
6 SASI_Rn01_00088744 predicted 22
7 SASI_Rn01_00088745 predicted 35
8 SASI_Rn02_00262835 predicted 328
9 SASI_Rn01_00088746 predicted 86
10 SASI_Rn01_00088747 predicted 73
11 SASI_Rn01_00088739 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010558 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140109 predicted 246
2 SASI_Mm01_00140110 predicted 214
3 SASI_Mm01_00140111 predicted 288
4 SASI_Mm01_00140112 predicted 575
5 SASI_Mm01_00140113 predicted 569
6 SASI_Mm01_00140114 predicted 591
7 SASI_Mm01_00140115 predicted 547
8 SASI_Mm01_00140116 predicted 523
9 SASI_Mm01_00140117 predicted 588
10 SASI_Mm01_00140118 predicted 797
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010558
IL5 MISSION shRNA Bacterial Glycerol Stock
interleukin 5 (colony-stimulating factor, eosinophil)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010558.1-324s1c1
Sequence:CCGGAGAAATACATTGACCGCCAAACTCGAGTTTGGCGGTCAATGTATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010558.1-397s1c1
Sequence:CCGGGCAAGAGTTCCTTGGTGTGATCTCGAGATCACACCAAGGAACTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010558.1-679s1c1
Sequence:CCGGGCCAAGGATAACCTTGAATTTCTCGAGAAATTCAAGGTTATCCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010558.1-223s1c1
Sequence:CCGGGCTATGCATTGGAGAAATCTTCTCGAGAAGATTTCTCCAATGCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010558.1-169s1c1
Sequence:CCGGGTTGACAAGCAATGAGACGATCTCGAGATCGTCTCATTGCTTGTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010558
IL5 MISSION shRNA shRNA Plasmid DNA
interleukin 5 (colony-stimulating factor, eosinophil)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010558.1-324s1c1
Sequence:CCGGAGAAATACATTGACCGCCAAACTCGAGTTTGGCGGTCAATGTATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010558.1-397s1c1
Sequence:CCGGGCAAGAGTTCCTTGGTGTGATCTCGAGATCACACCAAGGAACTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010558.1-679s1c1
Sequence:CCGGGCCAAGGATAACCTTGAATTTCTCGAGAAATTCAAGGTTATCCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010558.1-223s1c1
Sequence:CCGGGCTATGCATTGGAGAAATCTTCTCGAGAAGATTTCTCCAATGCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010558.1-169s1c1
Sequence:CCGGGTTGACAAGCAATGAGACGATCTCGAGATCGTCTCATTGCTTGTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010558
IL5 MISSION shRNA Lentiviral Transduction Particles
interleukin 5 (colony-stimulating factor, eosinophil)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010558.1-324s1c1
Sequence:CCGGAGAAATACATTGACCGCCAAACTCGAGTTTGGCGGTCAATGTATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010558.1-397s1c1
Sequence:CCGGGCAAGAGTTCCTTGGTGTGATCTCGAGATCACACCAAGGAACTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010558.1-679s1c1
Sequence:CCGGGCCAAGGATAACCTTGAATTTCTCGAGAAATTCAAGGTTATCCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010558.1-223s1c1
Sequence:CCGGGCTATGCATTGGAGAAATCTTCTCGAGAAGATTTCTCCAATGCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010558.1-169s1c1
Sequence:CCGGGTTGACAAGCAATGAGACGATCTCGAGATCGTCTCATTGCTTGTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000879
IL5 MISSION shRNA Bacterial Glycerol Stock
interleukin 5 (colony-stimulating factor, eosinophil)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000879.2-165s1c1
Sequence:CCGGCGAACTCTGCTGATAGCCAATCTCGAGATTGGCTATCAGCAGAGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000879.2-401s1c1
Sequence:CCGGGCAAGAGTTTCTTGGTGTAATCTCGAGATTACACCAAGAAACTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000879.2-148s1c1
Sequence:CCGGCACTGCTTTCTACTCATCGAACTCGAGTTCGATGAGTAGAAAGCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000879.2-427s1c1
Sequence:CCGGCCGAGTGGATAATAGAAAGTTCTCGAGAACTTTCTATTATCCACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000879.2-197s21c1
Sequence:CCGGGATTCCTGTTCCTGTACATAACTCGAGTTATGTACAGGAACAGGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000879.2-287s21c1
Sequence:CCGGGGGTACTGTGGAAAGACTATTCTCGAGAATAGTCTTTCCACAGTACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000879.2-523s21c1
Sequence:CCGGGAAAGAGTCAGGCCTTAATTTCTCGAGAAATTAAGGCCTGACTCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000879
IL5 MISSION shRNA shRNA Plasmid DNA
interleukin 5 (colony-stimulating factor, eosinophil)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000879.2-165s1c1
Sequence:CCGGCGAACTCTGCTGATAGCCAATCTCGAGATTGGCTATCAGCAGAGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000879.2-401s1c1
Sequence:CCGGGCAAGAGTTTCTTGGTGTAATCTCGAGATTACACCAAGAAACTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000879.2-148s1c1
Sequence:CCGGCACTGCTTTCTACTCATCGAACTCGAGTTCGATGAGTAGAAAGCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000879.2-427s1c1
Sequence:CCGGCCGAGTGGATAATAGAAAGTTCTCGAGAACTTTCTATTATCCACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000879.2-197s21c1
Sequence:CCGGGATTCCTGTTCCTGTACATAACTCGAGTTATGTACAGGAACAGGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000879.2-287s21c1
Sequence:CCGGGGGTACTGTGGAAAGACTATTCTCGAGAATAGTCTTTCCACAGTACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000879.2-523s21c1
Sequence:CCGGGAAAGAGTCAGGCCTTAATTTCTCGAGAAATTAAGGCCTGACTCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000879
IL5 MISSION shRNA Lentiviral Transduction Particles
interleukin 5 (colony-stimulating factor, eosinophil)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000879.2-165s1c1
Sequence:CCGGCGAACTCTGCTGATAGCCAATCTCGAGATTGGCTATCAGCAGAGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000879.2-401s1c1
Sequence:CCGGGCAAGAGTTTCTTGGTGTAATCTCGAGATTACACCAAGAAACTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000879.2-148s1c1
Sequence:CCGGCACTGCTTTCTACTCATCGAACTCGAGTTCGATGAGTAGAAAGCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000879.2-427s1c1
Sequence:CCGGCCGAGTGGATAATAGAAAGTTCTCGAGAACTTTCTATTATCCACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000879.2-197s21c1
Sequence:CCGGGATTCCTGTTCCTGTACATAACTCGAGTTATGTACAGGAACAGGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000879.2-287s21c1
Sequence:CCGGGGGTACTGTGGAAAGACTATTCTCGAGAATAGTCTTTCCACAGTACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000879.2-523s21c1
Sequence:CCGGGAAAGAGTCAGGCCTTAATTTCTCGAGAAATTAAGGCCTGACTCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)