EMAIL THIS PAGE TO A FRIEND

IL6

interleukin 6 (interferon, beta 2)

129 Gene Product Result for
Synonyms: BSF2 HGF HSF IFNB2 IL-6
UniProtKB ID: P05231, Q9UCU2, Q9UCU3, Q9UCU4
Gene ID:
Human(3569) Summary: This gene encodes a cytokine that functions in inflammation and the maturation of B cells. In addition, the encoded protein has been shown to be an endogenous pyrogen capable of inducing fever in people with autoimmune diseases or infections. The protein is primarily produced at sites of acute and chronic inflammation, where it is secreted into the serum and induces a transcriptional inflammatory response through interleukin 6 receptor, alpha. The functioning of this gene is implicated in a wide variety of inflammation-associated disease states, including suspectibility to diabetes mellitus and systemic juvenile rheumatoid arthritis. [provided by RefSeq, Jun 2011]
Mouse(16193) interleukin 6
Rat(24498) interleukin 6
Goat(100860785) interleukin 6 (interferon, beta 2)
sheep(443406) interleukin 6 (interferon, beta 2)
Domestic Rabbit(100008733) interleukin 6 (interferon, beta 2)
naked mole-rat(101702602) interleukin 6 (interferon, beta 2)
Zebrafish(100885851) interleukin 6 (interferon, beta 2)
domestic cat(493687) interleukin 6 (interferon, beta 2)
cow(280826) interleukin 6 (interferon, beta 2)
cow(517016) interleukin 6 (interferon, beta 2)
Horse(100034196) interleukin 6 (interferon, beta 2)
dog(403985) interleukin 6 (interferon, beta 2)
chicken(395337) interleukin 6 (interferon, beta 2)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301665 Anti-IL6 affinity isolated antibody human
immunohistochemistry pricing
SAB1400139 Anti-IL6 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1408591 Anti-IL6 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
proximity ligation assay, western blot pricing
SAB4200754 Anti-IL6 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunoprecipitation (IP), western blot pricing
SAB4200734 Anti-IL6 high affinity antibody, Mouse monoclonal clone IL6-2A3, purified from hybridoma cell culture human
ELISA, immunoprecipitation (IP), western blot pricing
SAB4200733 Anti-IL6 high affinity antibody, Mouse monoclonal clone IL6-4G1, purified from hybridoma cell culture human
ELISA, immunoprecipitation (IP), western blot pricing
GW22495 Anti-Interleukin-6 antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, western blot pricing
I2143 Anti-Interleukin-6 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
neutralization, radioimmunoassay pricing
SAB3300065 Monoclonal Anti-IL-6 antibody produced in mouse clone 2C9, purified immunoglobulin, buffered aqueous glycerol solution human
western blot pricing
SAB3300071 Monoclonal Anti-IL-6 antibody produced in mouse clone 3H6, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, western blot pricing
WH0003569M1 Monoclonal Anti-IL6 antibody produced in mouse clone 3E4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1400140 Monoclonal Anti-IL6 antibody produced in mouse clone 2D12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403971 Monoclonal Anti-IL6, (C-terminal) antibody produced in mouse clone 3F4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
I7901 Monoclonal Anti-Interleukin-6 antibody produced in mouse clone 6708.11, purified immunoglobulin, lyophilized powder human
ELISA, neutralization, western blot pricing
MSAB001 SILuRich Anti-IL6 MAb, biotin conjugated clone IL6-4G1, purified from hybridoma cell culture human
immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031168 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031168 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031168 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000600 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000600 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000600 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000600 Rosetta Predictions human pricing
NM_012589 Rosetta Predictions rat pricing
NM_031168 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155911 predicted 266
2 SASI_Hs01_00155912 predicted 198
3 SASI_Hs02_00302884 predicted 366
4 SASI_Hs02_00302885 predicted 246
5 SASI_Hs01_00155915 predicted 381
6 SASI_Hs01_00155916 predicted 485
7 SASI_Hs01_00155917 predicted 265
8 SASI_Hs01_00155919 predicted 355
9 SASI_Hs02_00302886 predicted 195
10 SASI_Hs02_00302887 predicted 302
11 SASI_Hs01_00155910 predicted 212
12 SASI_Hs01_00155913 predicted 362
13 SASI_Hs01_00155914 predicted 239
14 SASI_Hs01_00155918 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012589 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034352 predicted 699
2 SASI_Rn01_00034353 predicted 761
3 SASI_Rn01_00034354 predicted 708
4 SASI_Rn01_00034355 predicted 501
5 SASI_Rn01_00034358 predicted 347
6 SASI_Rn01_00034359 predicted 295
7 SASI_Rn01_00034360 predicted 324
8 SASI_Rn01_00034361 predicted 276
9 SASI_Rn02_00259733 predicted 713
10 SASI_Rn02_00259734 predicted 673
11 SASI_Rn01_00034356 predicted 241
12 SASI_Rn01_00034357 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031168 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080351 predicted 259
2 SASI_Mm01_00080352 predicted 681
3 SASI_Mm01_00080353 predicted 461
4 SASI_Mm01_00080354 predicted 240
5 SASI_Mm01_00080355 predicted 246
6 SASI_Mm01_00080356 predicted 535
7 SASI_Mm01_00080357 predicted 731
8 SASI_Mm01_00080359 predicted 638
9 SASI_Mm01_00080360 predicted 399
10 SASI_Mm02_00336994 predicted 293
11 SASI_Mm01_00080358 predicted 682
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031168
IL6 MISSION shRNA Bacterial Glycerol Stock
interleukin 6 (interferon, beta 2)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031168.1-302s1c1
Sequence:CCGGCCAGAGATACAAAGAAATGATCTCGAGATCATTTCTTTGTATCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031168.1-447s1c1
Sequence:CCGGCCAGAGTCCTTCAGAGAGATACTCGAGTATCTCTCTGAAGGACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031168.1-540s1c1
Sequence:CCGGCCAATGCTCTCCTAACAGATACTCGAGTATCTGTTAGGAGAGCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031168.1-161s1c1
Sequence:CCGGCCTGTCTATACCACTTCACAACTCGAGTTGTGAAGTGGTATAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031168.1-240s1c1
Sequence:CCGGGCAATGGCAATTCTGATTGTACTCGAGTACAATCAGAATTGCCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031168.1-302s1c2
Sequence:CCGGCCAGAGATACAAAGAAATGATCTCGAGATCATTTCTTTGTATCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031168
IL6 MISSION shRNA shRNA Plasmid DNA
interleukin 6 (interferon, beta 2)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031168.1-302s1c1
Sequence:CCGGCCAGAGATACAAAGAAATGATCTCGAGATCATTTCTTTGTATCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031168.1-447s1c1
Sequence:CCGGCCAGAGTCCTTCAGAGAGATACTCGAGTATCTCTCTGAAGGACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031168.1-540s1c1
Sequence:CCGGCCAATGCTCTCCTAACAGATACTCGAGTATCTGTTAGGAGAGCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031168.1-161s1c1
Sequence:CCGGCCTGTCTATACCACTTCACAACTCGAGTTGTGAAGTGGTATAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031168.1-240s1c1
Sequence:CCGGGCAATGGCAATTCTGATTGTACTCGAGTACAATCAGAATTGCCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031168.1-302s1c2
Sequence:CCGGCCAGAGATACAAAGAAATGATCTCGAGATCATTTCTTTGTATCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031168
IL6 MISSION shRNA Lentiviral Transduction Particles
interleukin 6 (interferon, beta 2)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031168.1-302s1c1
Sequence:CCGGCCAGAGATACAAAGAAATGATCTCGAGATCATTTCTTTGTATCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031168.1-447s1c1
Sequence:CCGGCCAGAGTCCTTCAGAGAGATACTCGAGTATCTCTCTGAAGGACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031168.1-540s1c1
Sequence:CCGGCCAATGCTCTCCTAACAGATACTCGAGTATCTGTTAGGAGAGCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031168.1-161s1c1
Sequence:CCGGCCTGTCTATACCACTTCACAACTCGAGTTGTGAAGTGGTATAGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031168.1-240s1c1
Sequence:CCGGGCAATGGCAATTCTGATTGTACTCGAGTACAATCAGAATTGCCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031168.1-302s1c2
Sequence:CCGGCCAGAGATACAAAGAAATGATCTCGAGATCATTTCTTTGTATCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000600
IL6 MISSION shRNA Bacterial Glycerol Stock
interleukin 6 (interferon, beta 2)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000600.1-373s1c1
Sequence:CCGGCTGGATTCAATGAGGAGACTTCTCGAGAAGTCTCCTCATTGAATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000600.1-211s1c1
Sequence:CCGGCAGAACGAATTGACAAACAAACTCGAGTTTGTTTGTCAATTCGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000600.1-636s1c1
Sequence:CCGGCATCTCATTCTGCGCAGCTTTCTCGAGAAAGCTGCGCAGAATGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000600.1-272s1c1
Sequence:CCGGGACATGTAACAAGAGTAACATCTCGAGATGTTACTCTTGTTACATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000600.3-861s21c1
Sequence:CCGGATGAGCGTTAGGACACTATTTCTCGAGAAATAGTGTCCTAACGCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000600.3-589s21c1
Sequence:CCGGCAAAGAATCTAGATGCAATAACTCGAGTTATTGCATCTAGATTCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000600.3-495s21c1
Sequence:CCGGGAGTACCTCCAGAACAGATTTCTCGAGAAATCTGTTCTGGAGGTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000600.3-912s21c1
Sequence:CCGGATGTGAAGCTGAGTTAATTTACTCGAGTAAATTAACTCAGCTTCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000600
IL6 MISSION shRNA shRNA Plasmid DNA
interleukin 6 (interferon, beta 2)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000600.1-373s1c1
Sequence:CCGGCTGGATTCAATGAGGAGACTTCTCGAGAAGTCTCCTCATTGAATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000600.1-211s1c1
Sequence:CCGGCAGAACGAATTGACAAACAAACTCGAGTTTGTTTGTCAATTCGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000600.1-636s1c1
Sequence:CCGGCATCTCATTCTGCGCAGCTTTCTCGAGAAAGCTGCGCAGAATGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000600.1-272s1c1
Sequence:CCGGGACATGTAACAAGAGTAACATCTCGAGATGTTACTCTTGTTACATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000600.3-861s21c1
Sequence:CCGGATGAGCGTTAGGACACTATTTCTCGAGAAATAGTGTCCTAACGCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000600.3-589s21c1
Sequence:CCGGCAAAGAATCTAGATGCAATAACTCGAGTTATTGCATCTAGATTCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000600.3-495s21c1
Sequence:CCGGGAGTACCTCCAGAACAGATTTCTCGAGAAATCTGTTCTGGAGGTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000600.3-912s21c1
Sequence:CCGGATGTGAAGCTGAGTTAATTTACTCGAGTAAATTAACTCAGCTTCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000600
IL6 MISSION shRNA Lentiviral Transduction Particles
interleukin 6 (interferon, beta 2)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000600.1-373s1c1
Sequence:CCGGCTGGATTCAATGAGGAGACTTCTCGAGAAGTCTCCTCATTGAATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000600.1-211s1c1
Sequence:CCGGCAGAACGAATTGACAAACAAACTCGAGTTTGTTTGTCAATTCGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000600.1-636s1c1
Sequence:CCGGCATCTCATTCTGCGCAGCTTTCTCGAGAAAGCTGCGCAGAATGAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000600.1-272s1c1
Sequence:CCGGGACATGTAACAAGAGTAACATCTCGAGATGTTACTCTTGTTACATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000600.3-861s21c1
Sequence:CCGGATGAGCGTTAGGACACTATTTCTCGAGAAATAGTGTCCTAACGCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000600.3-589s21c1
Sequence:CCGGCAAAGAATCTAGATGCAATAACTCGAGTTATTGCATCTAGATTCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000600.3-495s21c1
Sequence:CCGGGAGTACCTCCAGAACAGATTTCTCGAGAAATCTGTTCTGGAGGTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000600.3-912s21c1
Sequence:CCGGATGTGAAGCTGAGTTAATTTACTCGAGTAAATTAACTCAGCTTCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)