EMAIL THIS PAGE TO A FRIEND

IL7

interleukin 7

143 Gene Product Result for
Synonyms: IL-7
UniProtKB ID: P13232, A0N0L3, Q5FBY5, Q5FBY9
Gene ID:
Human(3574) Summary: The protein encoded by this gene is a cytokine important for B and T cell development. This cytokine and the hepatocyte growth factor (HGF) form a heterodimer that functions as a pre-pro-B cell growth-stimulating factor. This cytokine is found to be a cofactor for V(D)J rearrangement of the T cell receptor beta (TCRB) during early T cell development. This cytokine can be produced locally by intestinal epithelial and epithelial goblet cells, and may serve as a regulatory factor for intestinal mucosal lymphocytes. Knockout studies in mice suggested that this cytokine plays an essential role in lymphoid cell survival. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their presence in normal tissues has not been confirmed.[provided by RefSeq, Dec 2010]
Mouse(16196) interleukin 7
Rat(25647) interleukin 7
chicken(420193) interleukin 7
domestic cat(101084597) interleukin 7
dog(751768) interleukin 7
cow(280827) interleukin 7
sheep(443341) interleukin 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000880 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000880 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000880 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008371 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008371 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008371 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046841 MISSION® esiRNA esiRNA human IL7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000880 Rosetta Predictions human pricing
NM_013110 Rosetta Predictions rat pricing
NM_008371 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208273 predicted 1227
2 SASI_Hs01_00208278 predicted 813
3 SASI_Hs01_00208279 predicted 1113
4 SASI_Hs01_00208281 predicted 1047
5 SASI_Hs01_00208282 predicted 1143
6 SASI_Hs02_00303419 predicted 1216
7 SASI_Hs02_00303420 predicted 1189
8 SASI_Hs02_00303421 predicted 689
9 SASI_Hs01_00208274 predicted 772
10 SASI_Hs01_00208275 predicted 849
11 SASI_Hs01_00208276 predicted 774
12 SASI_Hs01_00208277 predicted 671
13 SASI_Hs01_00208280 predicted 1052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013110 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260885 predicted 294
2 SASI_Rn01_00115113 predicted 337
3 SASI_Rn01_00115114 predicted 643
4 SASI_Rn01_00115115 predicted 254
5 SASI_Rn01_00115116 predicted 585
6 SASI_Rn01_00115117 predicted 452
7 SASI_Rn01_00115120 predicted 510
8 SASI_Rn01_00115121 predicted 294
9 SASI_Rn01_00115122 predicted 521
10 SASI_Rn02_00260886 predicted 309
11 SASI_Rn01_00115118 predicted 587
12 SASI_Rn01_00115119 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008371 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180758 predicted 419
2 SASI_Mm02_00313732 predicted 574
3 SASI_Mm01_00180759 predicted 406
4 SASI_Mm01_00180763 predicted 730
5 SASI_Mm01_00180764 predicted 411
6 SASI_Mm01_00180765 predicted 552
7 SASI_Mm01_00180766 predicted 355
8 SASI_Mm02_00313733 predicted 331
9 SASI_Mm02_00313734 predicted 633
10 SASI_Mm02_00313735 predicted 340
11 SASI_Mm01_00180760 predicted 504
12 SASI_Mm01_00180761 predicted 414
13 SASI_Mm01_00180762 predicted 428
14 SASI_Mm01_00180767 predicted 555
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000880
IL7 MISSION shRNA Bacterial Glycerol Stock
interleukin 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000880.2-854s1c1
Sequence:CCGGGCTCGCAAGTTGAGGCAATTTCTCGAGAAATTGCCTCAACTTGCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000880.2-1060s1c1
Sequence:CCGGGTGTTTCCTAAAGAGACTATTCTCGAGAATAGTCTCTTTAGGAAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000880.2-817s1c1
Sequence:CCGGTGATGCTAATAAGGAAGGTATCTCGAGATACCTTCCTTATTAGCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000880.2-736s1c1
Sequence:CCGGCGATCAATTATTGGACAGCATCTCGAGATGCTGTCCAATAATTGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000880.2-668s1c1
Sequence:CCGGGCATCATCTGATTGTGATATTCTCGAGAATATCACAATCAGATGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000880.2-1537s21c1
Sequence:CCGGGCTCACTATGAATCTATTATACTCGAGTATAATAGATTCATAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000880.2-1411s21c1
Sequence:CCGGTAAGGTATCAGTTGCAATAATCTCGAGATTATTGCAACTGATACCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000880
IL7 MISSION shRNA shRNA Plasmid DNA
interleukin 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000880.2-854s1c1
Sequence:CCGGGCTCGCAAGTTGAGGCAATTTCTCGAGAAATTGCCTCAACTTGCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000880.2-1060s1c1
Sequence:CCGGGTGTTTCCTAAAGAGACTATTCTCGAGAATAGTCTCTTTAGGAAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000880.2-817s1c1
Sequence:CCGGTGATGCTAATAAGGAAGGTATCTCGAGATACCTTCCTTATTAGCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000880.2-736s1c1
Sequence:CCGGCGATCAATTATTGGACAGCATCTCGAGATGCTGTCCAATAATTGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000880.2-668s1c1
Sequence:CCGGGCATCATCTGATTGTGATATTCTCGAGAATATCACAATCAGATGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000880.2-1537s21c1
Sequence:CCGGGCTCACTATGAATCTATTATACTCGAGTATAATAGATTCATAGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000880.2-1411s21c1
Sequence:CCGGTAAGGTATCAGTTGCAATAATCTCGAGATTATTGCAACTGATACCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000880
IL7 MISSION shRNA Lentiviral Transduction Particles
interleukin 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000880.2-854s1c1
Sequence:CCGGGCTCGCAAGTTGAGGCAATTTCTCGAGAAATTGCCTCAACTTGCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000880.2-1060s1c1
Sequence:CCGGGTGTTTCCTAAAGAGACTATTCTCGAGAATAGTCTCTTTAGGAAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000880.2-817s1c1
Sequence:CCGGTGATGCTAATAAGGAAGGTATCTCGAGATACCTTCCTTATTAGCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000880.2-736s1c1
Sequence:CCGGCGATCAATTATTGGACAGCATCTCGAGATGCTGTCCAATAATTGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000880.2-668s1c1
Sequence:CCGGGCATCATCTGATTGTGATATTCTCGAGAATATCACAATCAGATGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000880.2-1537s21c1
Sequence:CCGGGCTCACTATGAATCTATTATACTCGAGTATAATAGATTCATAGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000880.2-1411s21c1
Sequence:CCGGTAAGGTATCAGTTGCAATAATCTCGAGATTATTGCAACTGATACCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008371
VALIDATED
IL7 MISSION shRNA Bacterial Glycerol Stock
interleukin 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008371.2-498s1c1
Sequence:CCGGGCTCGCAAGTTGAAGCAATTTCTCGAGAAATTGCTTCAACTTGCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008371.2-324s1c1
Sequence:CCGGGAGTGCCACATTAAAGACAAACTCGAGTTTGTCTTTAATGTGGCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008371.2-537s1c1
Sequence:CCGGGAAGAATTCAATGTCCACTTACTCGAGTAAGTGGACATTGAATTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008371.2-642s1c1
Sequence:CCGGGCATGTTTCCTAAAGAGACTACTCGAGTAGTCTCTTTAGGAAACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008371.2-409s1c1
Sequence:CCGGCTGATAGTAATTGCCCGAATACTCGAGTATTCGGGCAATTACTATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008371.4-497s21c1
Sequence:CCGGGCTCGCAAGTTGAAGCAATTTCTCGAGAAATTGCTTCAACTTGCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008371.4-641s21c1
Sequence:CCGGGCATGTTTCCTAAAGAGACTACTCGAGTAGTCTCTTTAGGAAACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008371.4-408s21c1
Sequence:CCGGCTGATAGTAATTGCCCGAATACTCGAGTATTCGGGCAATTACTATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008371.4-323s21c1
Sequence:CCGGGAGTGCCACATTAAAGACAAACTCGAGTTTGTCTTTAATGTGGCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008371
VALIDATED
IL7 MISSION shRNA shRNA Plasmid DNA
interleukin 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008371.2-498s1c1
Sequence:CCGGGCTCGCAAGTTGAAGCAATTTCTCGAGAAATTGCTTCAACTTGCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008371.2-324s1c1
Sequence:CCGGGAGTGCCACATTAAAGACAAACTCGAGTTTGTCTTTAATGTGGCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008371.2-537s1c1
Sequence:CCGGGAAGAATTCAATGTCCACTTACTCGAGTAAGTGGACATTGAATTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008371.2-642s1c1
Sequence:CCGGGCATGTTTCCTAAAGAGACTACTCGAGTAGTCTCTTTAGGAAACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008371.2-409s1c1
Sequence:CCGGCTGATAGTAATTGCCCGAATACTCGAGTATTCGGGCAATTACTATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008371.4-497s21c1
Sequence:CCGGGCTCGCAAGTTGAAGCAATTTCTCGAGAAATTGCTTCAACTTGCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008371.4-641s21c1
Sequence:CCGGGCATGTTTCCTAAAGAGACTACTCGAGTAGTCTCTTTAGGAAACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008371.4-408s21c1
Sequence:CCGGCTGATAGTAATTGCCCGAATACTCGAGTATTCGGGCAATTACTATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008371.4-323s21c1
Sequence:CCGGGAGTGCCACATTAAAGACAAACTCGAGTTTGTCTTTAATGTGGCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008371
VALIDATED
IL7 MISSION shRNA Lentiviral Transduction Particles
interleukin 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008371.2-498s1c1
Sequence:CCGGGCTCGCAAGTTGAAGCAATTTCTCGAGAAATTGCTTCAACTTGCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008371.2-324s1c1
Sequence:CCGGGAGTGCCACATTAAAGACAAACTCGAGTTTGTCTTTAATGTGGCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008371.2-537s1c1
Sequence:CCGGGAAGAATTCAATGTCCACTTACTCGAGTAAGTGGACATTGAATTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008371.2-642s1c1
Sequence:CCGGGCATGTTTCCTAAAGAGACTACTCGAGTAGTCTCTTTAGGAAACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008371.2-409s1c1
Sequence:CCGGCTGATAGTAATTGCCCGAATACTCGAGTATTCGGGCAATTACTATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008371.4-497s21c1
Sequence:CCGGGCTCGCAAGTTGAAGCAATTTCTCGAGAAATTGCTTCAACTTGCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008371.4-641s21c1
Sequence:CCGGGCATGTTTCCTAAAGAGACTACTCGAGTAGTCTCTTTAGGAAACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008371.4-408s21c1
Sequence:CCGGCTGATAGTAATTGCCCGAATACTCGAGTATTCGGGCAATTACTATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008371.4-323s21c1
Sequence:CCGGGAGTGCCACATTAAAGACAAACTCGAGTTTGTCTTTAATGTGGCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)