EMAIL THIS PAGE TO A FRIEND

IL7R

interleukin 7 receptor

65 Gene Product Result for
Synonyms: CD127 CDW127 IL-7R-alpha IL7RA ILRA
Gene ID:
Human(3575) Summary: The protein encoded by this gene is a receptor for interleukine 7 (IL7). The function of this receptor requires the interleukin 2 receptor, gamma chain (IL2RG), which is a common gamma chain shared by the receptors of various cytokines, including interleukine 2, 4, 7, 9, and 15. This protein has been shown to play a critical role in the V(D)J recombination during lymphocyte development. This protein is also found to control the accessibility of the TCR gamma locus by STAT5 and histone acetylation. Knockout studies in mice suggested that blocking apoptosis is an essential function of this protein during differentiation and activation of T lymphocytes. The functional defects in this protein may be associated with the pathogenesis of the severe combined immunodeficiency (SCID). [provided by RefSeq, Jul 2008]
Mouse(16197) interleukin 7 receptor
Rat(294797) interleukin 7 receptor
sheep(101111126) interleukin 7 receptor
Domestic Rabbit(100343726) interleukin 7 receptor
domestic guinea pig(100714027) interleukin 7 receptor
naked mole-rat(101710077) interleukin 7 receptor
Zebrafish(100134973) interleukin 7 receptor
dog(612582) interleukin 7 receptor
domestic cat(101100697) interleukin 7 receptor
Horse(100034169) interleukin 7 receptor
cow(521554) interleukin 7 receptor
chicken(426054) interleukin 7 receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002185 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002185 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002185 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008372 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008372 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008372 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066561 MISSION® esiRNA esiRNA human IL7R (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
MABF385 Anti-CD127 (IL-7Ra) Antibody (human), APC, clone R34-34 This Mouse Monoclonal Antibody Anti-CD127 (IL-7Ra) (human), APC, clone R34-34, Cat. No. MABF385 is validated for use in FC for the detection of CD127 (IL-7Ra). pricing
MABF543 Anti-CD127 (IL-7Ra) Antibody (human), PE, clone A7R34 This mouse monoclonal antibody Anti-CD127 (IL-7Ra) (human), PE & clone A7R34 validated for use in Flow Cytometry for the detection of CD127 (IL-7Ra). pricing
MABF386 Anti-CD127 (IL-7Ra) Antibody (human), PE, clone R34-34 This Mouse Monoclonal Antibody Anti-CD127 (IL-7Ra) (human), PE, clone R34-34, Cat. No. MABF386 is validated for use in FC for the detection of CD127 (IL-7Ra). pricing
MABF535 Anti-CD127 (IL-7Ra) Antibody (mouse), APC, clone A7R34 This rat monoclonal antibody Anti-CD127 (IL-7Ra) (mouse), APC, clone A7R34 validated for use in IP, Flow Cytometry & IHC for the detection of CD127 (IL-7Ra). pricing
MABF542 Anti-CD127 (IL-7Ra) Antibody (mouse), APC, clone R34-34 This mouse monoclonal antibody Anti-CD127 (IL-7Ra) (mouse), APC & clone R34-34 validated for use in Flow Cytometry for the detection of CD127 (IL-7Ra). pricing
MABF151A Anti-CD127 (IL-7Ra) (mouse), violetFluor™ 450, clone A7R34 Antibody Anti-CD127 (IL-7Ra) (mouse), violetFluor™ 450, clone A7R34 Antibody detects level of CD127 and has been published and validated for use in Flow Cytometry. pricing
06-1085-I Anti-IL-7Ra (CD127), extracellular Antibody This Anti-IL-7Ra (CD127), extracellular Antibody is validated for use in Western Blotting and Flow Cytometry for the detection of IL-7Ra (CD127), extracellular. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002185 Rosetta Predictions human pricing
NM_001106418 Rosetta Predictions rat pricing
NM_008372 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333405 predicted 615
2 SASI_Hs01_00104758 predicted 1293
3 SASI_Hs01_00104759 predicted 625
4 SASI_Hs01_00104761 predicted 398
5 SASI_Hs01_00104762 predicted 280
6 SASI_Hs01_00104764 predicted 736
7 SASI_Hs01_00104765 predicted 1485
8 SASI_Hs01_00104766 predicted 458
9 SASI_Hs01_00104767 predicted 1472
10 SASI_Hs02_00333406 predicted 1488
11 SASI_Hs01_00104760 predicted 688
12 SASI_Hs01_00104763 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106418 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218768 predicted 388
2 SASI_Rn02_00218769 predicted 1369
3 SASI_Rn02_00218770 predicted 801
4 SASI_Rn02_00218771 predicted 896
5 SASI_Rn02_00218772 predicted 1407
6 SASI_Rn02_00218773 predicted 958
7 SASI_Rn02_00218774 predicted 469
8 SASI_Rn02_00218775 predicted 1096
9 SASI_Rn02_00218776 predicted 437
10 SASI_Rn02_00218777 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008372 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054108 predicted 366
2 SASI_Mm01_00054109 predicted 536
3 SASI_Mm01_00054110 predicted 441
4 SASI_Mm01_00054111 predicted 1414
5 SASI_Mm02_00313736 predicted 1012
6 SASI_Mm01_00054112 predicted 432
7 SASI_Mm01_00054113 predicted 1344
8 SASI_Mm01_00054115 predicted 532
9 SASI_Mm01_00054116 predicted 1456
10 SASI_Mm01_00054117 predicted 1224
11 SASI_Mm01_00054114 predicted 1431
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002185
IL7R MISSION shRNA Bacterial Glycerol Stock
interleukin 7 receptor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002185.2-272s21c1
Sequence:CCGGCCCAGATGTCAACATCACCAACTCGAGTTGGTGATGTTGACATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002185.2-1396s21c1
Sequence:CCGGCCATTCTTACTTCCCTGGGATCTCGAGATCCCAGGGAAGTAAGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002185.2-679s21c1
Sequence:CCGGCGGCAGCAATGTATGAGATTACTCGAGTAATCTCATACATTGCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002185.2-390s21c1
Sequence:CCGGCTGATTGGAAAGAGCAATATACTCGAGTATATTGCTCTTTCCAATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002185.2-1174s21c1
Sequence:CCGGGAAGAGATTCATCCCTCACATCTCGAGATGTGAGGGATGAATCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002185.2-679s1c1
Sequence:CCGGCGGCAGCAATGTATGAGATTACTCGAGTAATCTCATACATTGCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002185.2-1396s1c1
Sequence:CCGGCCATTCTTACTTCCCTGGGATCTCGAGATCCCAGGGAAGTAAGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002185.2-390s1c1
Sequence:CCGGCTGATTGGAAAGAGCAATATACTCGAGTATATTGCTCTTTCCAATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002185.2-1174s1c1
Sequence:CCGGGAAGAGATTCATCCCTCACATCTCGAGATGTGAGGGATGAATCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002185.2-272s1c1
Sequence:CCGGCCCAGATGTCAACATCACCAACTCGAGTTGGTGATGTTGACATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002185
IL7R MISSION shRNA shRNA Plasmid DNA
interleukin 7 receptor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002185.2-272s21c1
Sequence:CCGGCCCAGATGTCAACATCACCAACTCGAGTTGGTGATGTTGACATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002185.2-1396s21c1
Sequence:CCGGCCATTCTTACTTCCCTGGGATCTCGAGATCCCAGGGAAGTAAGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002185.2-679s21c1
Sequence:CCGGCGGCAGCAATGTATGAGATTACTCGAGTAATCTCATACATTGCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002185.2-390s21c1
Sequence:CCGGCTGATTGGAAAGAGCAATATACTCGAGTATATTGCTCTTTCCAATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002185.2-1174s21c1
Sequence:CCGGGAAGAGATTCATCCCTCACATCTCGAGATGTGAGGGATGAATCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002185.2-679s1c1
Sequence:CCGGCGGCAGCAATGTATGAGATTACTCGAGTAATCTCATACATTGCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002185.2-1396s1c1
Sequence:CCGGCCATTCTTACTTCCCTGGGATCTCGAGATCCCAGGGAAGTAAGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002185.2-390s1c1
Sequence:CCGGCTGATTGGAAAGAGCAATATACTCGAGTATATTGCTCTTTCCAATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002185.2-1174s1c1
Sequence:CCGGGAAGAGATTCATCCCTCACATCTCGAGATGTGAGGGATGAATCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002185.2-272s1c1
Sequence:CCGGCCCAGATGTCAACATCACCAACTCGAGTTGGTGATGTTGACATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002185
IL7R MISSION shRNA Lentiviral Transduction Particles
interleukin 7 receptor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002185.2-272s21c1
Sequence:CCGGCCCAGATGTCAACATCACCAACTCGAGTTGGTGATGTTGACATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002185.2-1396s21c1
Sequence:CCGGCCATTCTTACTTCCCTGGGATCTCGAGATCCCAGGGAAGTAAGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002185.2-679s21c1
Sequence:CCGGCGGCAGCAATGTATGAGATTACTCGAGTAATCTCATACATTGCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002185.2-390s21c1
Sequence:CCGGCTGATTGGAAAGAGCAATATACTCGAGTATATTGCTCTTTCCAATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002185.2-1174s21c1
Sequence:CCGGGAAGAGATTCATCCCTCACATCTCGAGATGTGAGGGATGAATCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002185.2-679s1c1
Sequence:CCGGCGGCAGCAATGTATGAGATTACTCGAGTAATCTCATACATTGCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002185.2-1396s1c1
Sequence:CCGGCCATTCTTACTTCCCTGGGATCTCGAGATCCCAGGGAAGTAAGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002185.2-390s1c1
Sequence:CCGGCTGATTGGAAAGAGCAATATACTCGAGTATATTGCTCTTTCCAATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002185.2-1174s1c1
Sequence:CCGGGAAGAGATTCATCCCTCACATCTCGAGATGTGAGGGATGAATCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002185.2-272s1c1
Sequence:CCGGCCCAGATGTCAACATCACCAACTCGAGTTGGTGATGTTGACATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008372
IL7R MISSION shRNA Bacterial Glycerol Stock
interleukin 7 receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008372.3-1183s1c1
Sequence:CCGGGCCCACCAGAAACAGTTAGAACTCGAGTTCTAACTGTTTCTGGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008372.3-1443s1c1
Sequence:CCGGCTGAATCAAGAAGAAGCGTATCTCGAGATACGCTTCTTCTTGATTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008372.3-1222s1c1
Sequence:CCGGGCCTGGCTAGAAATCTGAGTACTCGAGTACTCAGATTTCTAGCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008372.3-151s1c1
Sequence:CCGGTCTGCTTAATTCAAGCTGTTTCTCGAGAAACAGCTTGAATTAAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008372.3-720s1c1
Sequence:CCGGGAAATCAAAGTCCGATCCATTCTCGAGAATGGATCGGACTTTGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008372
IL7R MISSION shRNA shRNA Plasmid DNA
interleukin 7 receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008372.3-1183s1c1
Sequence:CCGGGCCCACCAGAAACAGTTAGAACTCGAGTTCTAACTGTTTCTGGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008372.3-1443s1c1
Sequence:CCGGCTGAATCAAGAAGAAGCGTATCTCGAGATACGCTTCTTCTTGATTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008372.3-1222s1c1
Sequence:CCGGGCCTGGCTAGAAATCTGAGTACTCGAGTACTCAGATTTCTAGCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008372.3-151s1c1
Sequence:CCGGTCTGCTTAATTCAAGCTGTTTCTCGAGAAACAGCTTGAATTAAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008372.3-720s1c1
Sequence:CCGGGAAATCAAAGTCCGATCCATTCTCGAGAATGGATCGGACTTTGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008372
IL7R MISSION shRNA Lentiviral Transduction Particles
interleukin 7 receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008372.3-1183s1c1
Sequence:CCGGGCCCACCAGAAACAGTTAGAACTCGAGTTCTAACTGTTTCTGGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008372.3-1443s1c1
Sequence:CCGGCTGAATCAAGAAGAAGCGTATCTCGAGATACGCTTCTTCTTGATTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008372.3-1222s1c1
Sequence:CCGGGCCTGGCTAGAAATCTGAGTACTCGAGTACTCAGATTTCTAGCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008372.3-151s1c1
Sequence:CCGGTCTGCTTAATTCAAGCTGTTTCTCGAGAAACAGCTTGAATTAAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008372.3-720s1c1
Sequence:CCGGGAAATCAAAGTCCGATCCATTCTCGAGAATGGATCGGACTTTGATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)