IL8

interleukin 8

43 Gene Product Result for

Synonyms: CXCL8 GCP-1 GCP1 LECT LUCT LYNAP MDNCF MONAP NAF NAP-1 NAP1

Species: Human IL8(3576), Zebrafish il8(100002946), cow IL8(280828), Horse IL8(100037400), domestic cat IL8(493836), dog IL8(403850), domestic guinea pig Il8(100379599), naked mole-rat Il8(101707734), sheep IL8(443418), Domestic Rabbit IL8(100009129)

UniProtKB ID: P10145, B2R4L8, Q6FGF6, Q6LAE6, Q96RG6, Q9C077, Q9UCE1, Q9UCR8

Gene ID:

Human(3576) Summary: The protein encoded by this gene is a member of the CXC chemokine family. This chemokine is one of the major mediators of the inflammatory response. This chemokine is secreted by several cell types. It functions as a chemoattractant, and is also a potent angiogenic factor. This gene is believed to play a role in the pathogenesis of bronchiolitis, a common respiratory tract disease caused by viral infection. This gene and other ten members of the CXC chemokine gene family form a chemokine gene cluster in a region mapped to chromosome 4q. [provided by RefSeq, Jul 2008]

Zebrafish(100002946) interleukin 8

cow(280828) interleukin 8

Horse(100037400) interleukin 8

domestic cat(493836) interleukin 8

dog(403850) interleukin 8

domestic guinea pig(100379599) interleukin 8

naked mole-rat(101707734) interleukin 8

sheep(443418) interleukin 8

Domestic Rabbit(100009129) interleukin 8

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

HPA057179	Anti-CXCL8 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunofluorescence, immunohistochemistry, western blot	pricing

GW21030	Anti-Interleukin-8 antibody produced in chicken affinity isolated antibody, buffered aqueous solution	human	ELISA, western blot	pricing

I8026	Anti-Interleukin-8 antibody produced in goat affinity isolated antibody, lyophilized powder	human	immunocytochemistry, immunohistochemistry, neutralization, western blot	pricing

SAB1409244	Monoclonal Anti-IL8 antibody produced in mouse clone 1B4, purified immunoglobulin, buffered aqueous solution	human	ELISA, immunoprecipitation (IP), western blot	pricing

SAB1409245	Monoclonal Anti-IL8 antibody produced in mouse clone 1A3, purified immunoglobulin, buffered aqueous solution	human	ELISA, immunoprecipitation (IP), western blot	pricing

SAB1409246	Monoclonal Anti-IL8 antibody produced in mouse clone 4E3, purified immunoglobulin, buffered aqueous solution	human	ELISA, immunoprecipitation (IP), western blot	pricing

SAB1409247	Monoclonal Anti-IL8 antibody produced in mouse clone 4F1, purified immunoglobulin, buffered aqueous solution	human	ELISA, immunoprecipitation (IP), western blot	pricing

WH0003576M5	Monoclonal Anti-IL8 antibody produced in mouse clone 6G4, purified immunoglobulin, buffered aqueous solution	human	ELISA, western blot	pricing

SAB1403974	Monoclonal Anti-IL8, (C-terminal) antibody produced in mouse clone 6D12, purified immunoglobulin, buffered aqueous solution	human	ELISA, western blot	pricing

I2519	Monoclonal Anti-Interleukin-8 antibody produced in mouse clone 6217, purified immunoglobulin, lyophilized powder	human	ELISA, flow cytometry, immunocytochemistry, neutralization, western blot	pricing

Proteins

Product #	Description	Species	Add to Cart

SRP3311	IL-8 (72AA) human Animal-component free, recombinant, expressed in E. coli, ≥98% (SDS-PAGE), ≥98% (HPLC)	human	pricing

SRP3098	IL-8 (77aa) (CXCL8) human recombinant, expressed in E. coli, ≥98% (SDS-PAGE), ≥98% (HPLC), suitable for cell culture	human	pricing

I1645	Interleukin-8 human ≥98% (SDS-PAGE and HPLC), recombinant, expressed in E. coli, lyophilized powder, suitable for cell culture	human	pricing

APREST77906	PrEST Antigen CXCL8 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

MSST0058	SILu^™Lite IL8, Interleukin-8 human recombinant, expressed in HEK 293 cells, MS Protein Standard	human	pricing

QPREST22991	SILu^™PrEST IL8 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

MSST0057	SILu^™Prot IL8, Interleukin-8 human recombinant, expressed in HEK 293 cells, SIL MS Protein Standard, ¹³C and ¹⁵N-labeled	human	pricing

ELISA

Product #	Description	Species	Add to Cart

RAB0318	Canine CXCL8 / IL-8 ELISA Kit for serum, plasma and cell culture supernatants	canine	pricing

RAB1217	Equine IL-8 ELISA for serum, plasma and cell culture supernatants	equine	pricing

RAB0595	Feline IL8 / Interleukin-8 ELISA Kit for serum, plasma and cell culture supernatants	feline	pricing

RAB0319	Human IL-8 / CXCL8 ELISA Kit for serum, plasma, cell culture supernatant and urine	human	pricing

RAB0320	Human IL-8 / CXCL8 ELISA Kit for cell and tissue lysates	human	pricing

RAB1110	Rabbit IL-8 ELISA Kit for cell culture supernatants, plasma, and serum samples	rabbit	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_000584	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_000584	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_000584	MISSION® shRNA Lentiviral Transduction Particles	human	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU048321	MISSION^® esiRNA targeting human CXCL8	human	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_000584	Rosetta Predictions	human	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_000584	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00222383 predicted	273
2	SASI_Hs01_00222384 predicted	270
3	SASI_Hs01_00222385 predicted	274
4	SASI_Hs01_00222386 predicted	255
5	SASI_Hs01_00222387 predicted	205
6	SASI_Hs01_00222388 predicted	210
7	SASI_Hs01_00222389 predicted	274
8	SASI_Hs01_00222390 predicted	195
9	SASI_Hs01_00222391 predicted	265
10	SASI_Hs01_00222392 predicted	275

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_000584 VALIDATED	IL8 MISSION shRNA Bacterial Glycerol Stock interleukin 8	Human

17 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000058032
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000584.2-281s1c1
	Sequence:CCGGCTGCGCCAACACAGAAATTATCTCGAGATAATTTCTGTGTTGGCGCAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000058028
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.7	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000584.2-727s1c1
	Sequence:CCGGCCGAACTTTAATTTCAGGAATCTCGAGATTCCTGAAATTAAAGTTCGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000058030
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.65	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000584.2-178s1c1
	Sequence:CCGGCAAGGAGTGCTAAAGAACTTACTCGAGTAAGTTCTTTAGCACTCCTTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000058029
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000584.2-285s1c1
	Sequence:CCGGGCCAACACAGAAATTATTGTACTCGAGTACAATAATTTCTGTGTTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000289264
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-727s21c1
	Sequence:CCGGCCGAACTTTAATTTCAGGAATCTCGAGATTCCTGAAATTAAAGTTCGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232050
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000584.2-129s21c1
	Sequence:CCGGTTGGCAGCCTTCCTGATTTCTCTCGAGAGAAATCAGGAAGGCTGCCAATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000369179
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-769s21c1
	Sequence:CCGGGATATTTGAAGCATCACATAACTCGAGTTATGTGATGCTTCAAATATCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000058031
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000584.2-153s1c1
	Sequence:CCGGGCTCTGTGTGAAGGTGCAGTTCTCGAGAACTGCACCTTCACACAGAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000369253
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-674s21c1
	Sequence:CCGGTGCACGGGAGAATATACAAATCTCGAGATTTGTATATTCTCCCGTGCATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000369181
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-465s21c1
	Sequence:CCGGTACTTCAACACTTCATGTATTCTCGAGAATACATGAAGTGTTGAAGTATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000369183
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-518s21c1
	Sequence:CCGGTACAAGATTCCTGGTTAAATTCTCGAGAATTTAACCAGGAATCTTGTATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000369178
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-810s21c1
	Sequence:CCGGTTGCCATAAAGTCAAATTTAGCTCGAGCTAAATTTGACTTTATGGCAATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232054
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-716s21c1
	Sequence:CCGGCAAGAGAATATCCGAACTTTACTCGAGTAAAGTTCGGATATTCTCTTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232053
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000584.2-282s21c1
	Sequence:CCGGTGCGCCAACACAGAAATTATTCTCGAGAATAATTTCTGTGTTGGCGCATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232052
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000584.2-251s21c1
	Sequence:CCGGAGAACTGAGAGTGATTGAGAGCTCGAGCTCTCAATCACTCTCAGTTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232051
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.56	Cell Line: A549
	TRC Version: 2	Clone ID:NM_000584.2-194s21c1
	Sequence:CCGGACTTAGATGTCAGTGCATAAACTCGAGTTTATGCACTGACATCTAAGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000369255
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-583s21c1
	Sequence:CCGGTATCCAGAACATACTTATATGCTCGAGCATATAAGTATGTTCTGGATATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_000584 VALIDATED	IL8 MISSION shRNA shRNA Plasmid DNA interleukin 8	Human

17 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000058032
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000584.2-281s1c1
	Sequence:CCGGCTGCGCCAACACAGAAATTATCTCGAGATAATTTCTGTGTTGGCGCAGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000058028
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.7	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000584.2-727s1c1
	Sequence:CCGGCCGAACTTTAATTTCAGGAATCTCGAGATTCCTGAAATTAAAGTTCGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000058030
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.65	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000584.2-178s1c1
	Sequence:CCGGCAAGGAGTGCTAAAGAACTTACTCGAGTAAGTTCTTTAGCACTCCTTGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000058029
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000584.2-285s1c1
	Sequence:CCGGGCCAACACAGAAATTATTGTACTCGAGTACAATAATTTCTGTGTTGGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000289264
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-727s21c1
	Sequence:CCGGCCGAACTTTAATTTCAGGAATCTCGAGATTCCTGAAATTAAAGTTCGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000232050
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000584.2-129s21c1
	Sequence:CCGGTTGGCAGCCTTCCTGATTTCTCTCGAGAGAAATCAGGAAGGCTGCCAATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000369179
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-769s21c1
	Sequence:CCGGGATATTTGAAGCATCACATAACTCGAGTTATGTGATGCTTCAAATATCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000058031
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000584.2-153s1c1
	Sequence:CCGGGCTCTGTGTGAAGGTGCAGTTCTCGAGAACTGCACCTTCACACAGAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000369253
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-674s21c1
	Sequence:CCGGTGCACGGGAGAATATACAAATCTCGAGATTTGTATATTCTCCCGTGCATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000369181
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-465s21c1
	Sequence:CCGGTACTTCAACACTTCATGTATTCTCGAGAATACATGAAGTGTTGAAGTATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000369183
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-518s21c1
	Sequence:CCGGTACAAGATTCCTGGTTAAATTCTCGAGAATTTAACCAGGAATCTTGTATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000369178
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-810s21c1
	Sequence:CCGGTTGCCATAAAGTCAAATTTAGCTCGAGCTAAATTTGACTTTATGGCAATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000232054
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-716s21c1
	Sequence:CCGGCAAGAGAATATCCGAACTTTACTCGAGTAAAGTTCGGATATTCTCTTGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000232053
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000584.2-282s21c1
	Sequence:CCGGTGCGCCAACACAGAAATTATTCTCGAGAATAATTTCTGTGTTGGCGCATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000232052
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000584.2-251s21c1
	Sequence:CCGGAGAACTGAGAGTGATTGAGAGCTCGAGCTCTCAATCACTCTCAGTTCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000232051
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.56	Cell Line: A549
	TRC Version: 2	Clone ID:NM_000584.2-194s21c1
	Sequence:CCGGACTTAGATGTCAGTGCATAAACTCGAGTTTATGCACTGACATCTAAGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000369255
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-583s21c1
	Sequence:CCGGTATCCAGAACATACTTATATGCTCGAGCATATAAGTATGTTCTGGATATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_000584 VALIDATED	IL8 MISSION shRNA Lentiviral Transduction Particles interleukin 8	Human

17 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000058032
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000584.2-281s1c1
	Sequence:CCGGCTGCGCCAACACAGAAATTATCTCGAGATAATTTCTGTGTTGGCGCAGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000058028
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.7	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000584.2-727s1c1
	Sequence:CCGGCCGAACTTTAATTTCAGGAATCTCGAGATTCCTGAAATTAAAGTTCGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000058030
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.65	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000584.2-178s1c1
	Sequence:CCGGCAAGGAGTGCTAAAGAACTTACTCGAGTAAGTTCTTTAGCACTCCTTGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000058029
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000584.2-285s1c1
	Sequence:CCGGGCCAACACAGAAATTATTGTACTCGAGTACAATAATTTCTGTGTTGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000289264
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-727s21c1
	Sequence:CCGGCCGAACTTTAATTTCAGGAATCTCGAGATTCCTGAAATTAAAGTTCGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232050
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000584.2-129s21c1
	Sequence:CCGGTTGGCAGCCTTCCTGATTTCTCTCGAGAGAAATCAGGAAGGCTGCCAATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000369179
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-769s21c1
	Sequence:CCGGGATATTTGAAGCATCACATAACTCGAGTTATGTGATGCTTCAAATATCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000058031
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000584.2-153s1c1
	Sequence:CCGGGCTCTGTGTGAAGGTGCAGTTCTCGAGAACTGCACCTTCACACAGAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000369253
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-674s21c1
	Sequence:CCGGTGCACGGGAGAATATACAAATCTCGAGATTTGTATATTCTCCCGTGCATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000369181
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-465s21c1
	Sequence:CCGGTACTTCAACACTTCATGTATTCTCGAGAATACATGAAGTGTTGAAGTATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000369183
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-518s21c1
	Sequence:CCGGTACAAGATTCCTGGTTAAATTCTCGAGAATTTAACCAGGAATCTTGTATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000369178
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-810s21c1
	Sequence:CCGGTTGCCATAAAGTCAAATTTAGCTCGAGCTAAATTTGACTTTATGGCAATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232054
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-716s21c1
	Sequence:CCGGCAAGAGAATATCCGAACTTTACTCGAGTAAAGTTCGGATATTCTCTTGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232053
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000584.2-282s21c1
	Sequence:CCGGTGCGCCAACACAGAAATTATTCTCGAGAATAATTTCTGTGTTGGCGCATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232052
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000584.2-251s21c1
	Sequence:CCGGAGAACTGAGAGTGATTGAGAGCTCGAGCTCTCAATCACTCTCAGTTCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232051
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.56	Cell Line: A549
	TRC Version: 2	Clone ID:NM_000584.2-194s21c1
	Sequence:CCGGACTTAGATGTCAGTGCATAAACTCGAGTTTATGCACTGACATCTAAGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000369255
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000584.2-583s21c1
	Sequence:CCGGTATCCAGAACATACTTATATGCTCGAGCATATAAGTATGTTCTGGATATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart