EMAIL THIS PAGE TO A FRIEND

IL8

interleukin 8

52 Gene Product Result for
Synonyms: CXCL8 GCP-1 GCP1 LECT LUCT LYNAP MDNCF MONAP NAF NAP-1 NAP1
Gene ID:
Human(3576) Summary: The protein encoded by this gene is a member of the CXC chemokine family. This chemokine is one of the major mediators of the inflammatory response. This chemokine is secreted by several cell types. It functions as a chemoattractant, and is also a potent angiogenic factor. This gene is believed to play a role in the pathogenesis of bronchiolitis, a common respiratory tract disease caused by viral infection. This gene and other ten members of the CXC chemokine gene family form a chemokine gene cluster in a region mapped to chromosome 4q. [provided by RefSeq, Jul 2008]
Zebrafish(100002946) interleukin 8
cow(280828) interleukin 8
Horse(100037400) interleukin 8
domestic cat(493836) interleukin 8
dog(403850) interleukin 8
sheep(443418) interleukin 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA057179 Anti-CXCL8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
GW21030 Anti-Interleukin-8 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
I8026 Anti-Interleukin-8 antibody produced in goat affinity isolated antibody, lyophilized powder human
immunocytochemistry, immunohistochemistry, neutralization, western blot pricing
WH0003576M5 Monoclonal Anti-IL8 antibody produced in mouse clone 6G4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409243 Monoclonal Anti-IL8 antibody produced in mouse clone 4G11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing
SAB1409244 Monoclonal Anti-IL8 antibody produced in mouse clone 1B4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing
SAB1409245 Monoclonal Anti-IL8 antibody produced in mouse clone 1A3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing
SAB1409246 Monoclonal Anti-IL8 antibody produced in mouse clone 4E3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing
SAB1409247 Monoclonal Anti-IL8 antibody produced in mouse clone 4F1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing
SAB1403974 Monoclonal Anti-IL8, (C-terminal) antibody produced in mouse clone 6D12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
I2519 Monoclonal Anti-Interleukin-8 antibody produced in mouse clone 6217, purified immunoglobulin, lyophilized powder human
ELISA, flow cytometry, immunocytochemistry, neutralization, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000584 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000584 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000584 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048321 MISSION® esiRNA esiRNA human IL8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000584 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222383 predicted 273
2 SASI_Hs01_00222384 predicted 270
3 SASI_Hs01_00222385 predicted 274
4 SASI_Hs01_00222386 predicted 255
5 SASI_Hs01_00222387 predicted 205
6 SASI_Hs01_00222388 predicted 210
7 SASI_Hs01_00222389 predicted 274
8 SASI_Hs01_00222390 predicted 195
9 SASI_Hs01_00222391 predicted 265
10 SASI_Hs01_00222392 predicted 275
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000584
VALIDATED
IL8 MISSION shRNA Bacterial Glycerol Stock
interleukin 8
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000584.2-281s1c1
Sequence:CCGGCTGCGCCAACACAGAAATTATCTCGAGATAATTTCTGTGTTGGCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_000584.2-727s1c1
Sequence:CCGGCCGAACTTTAATTTCAGGAATCTCGAGATTCCTGAAATTAAAGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000584.2-178s1c1
Sequence:CCGGCAAGGAGTGCTAAAGAACTTACTCGAGTAAGTTCTTTAGCACTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000584.2-285s1c1
Sequence:CCGGGCCAACACAGAAATTATTGTACTCGAGTACAATAATTTCTGTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-727s21c1
Sequence:CCGGCCGAACTTTAATTTCAGGAATCTCGAGATTCCTGAAATTAAAGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000584.2-129s21c1
Sequence:CCGGTTGGCAGCCTTCCTGATTTCTCTCGAGAGAAATCAGGAAGGCTGCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-769s21c1
Sequence:CCGGGATATTTGAAGCATCACATAACTCGAGTTATGTGATGCTTCAAATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000584.2-153s1c1
Sequence:CCGGGCTCTGTGTGAAGGTGCAGTTCTCGAGAACTGCACCTTCACACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-674s21c1
Sequence:CCGGTGCACGGGAGAATATACAAATCTCGAGATTTGTATATTCTCCCGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-465s21c1
Sequence:CCGGTACTTCAACACTTCATGTATTCTCGAGAATACATGAAGTGTTGAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-518s21c1
Sequence:CCGGTACAAGATTCCTGGTTAAATTCTCGAGAATTTAACCAGGAATCTTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-810s21c1
Sequence:CCGGTTGCCATAAAGTCAAATTTAGCTCGAGCTAAATTTGACTTTATGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-716s21c1
Sequence:CCGGCAAGAGAATATCCGAACTTTACTCGAGTAAAGTTCGGATATTCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000584.2-282s21c1
Sequence:CCGGTGCGCCAACACAGAAATTATTCTCGAGAATAATTTCTGTGTTGGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000584.2-251s21c1
Sequence:CCGGAGAACTGAGAGTGATTGAGAGCTCGAGCTCTCAATCACTCTCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_000584.2-194s21c1
Sequence:CCGGACTTAGATGTCAGTGCATAAACTCGAGTTTATGCACTGACATCTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-583s21c1
Sequence:CCGGTATCCAGAACATACTTATATGCTCGAGCATATAAGTATGTTCTGGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000584
VALIDATED
IL8 MISSION shRNA shRNA Plasmid DNA
interleukin 8
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000584.2-281s1c1
Sequence:CCGGCTGCGCCAACACAGAAATTATCTCGAGATAATTTCTGTGTTGGCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_000584.2-727s1c1
Sequence:CCGGCCGAACTTTAATTTCAGGAATCTCGAGATTCCTGAAATTAAAGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000584.2-178s1c1
Sequence:CCGGCAAGGAGTGCTAAAGAACTTACTCGAGTAAGTTCTTTAGCACTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000584.2-285s1c1
Sequence:CCGGGCCAACACAGAAATTATTGTACTCGAGTACAATAATTTCTGTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-727s21c1
Sequence:CCGGCCGAACTTTAATTTCAGGAATCTCGAGATTCCTGAAATTAAAGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000584.2-129s21c1
Sequence:CCGGTTGGCAGCCTTCCTGATTTCTCTCGAGAGAAATCAGGAAGGCTGCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-769s21c1
Sequence:CCGGGATATTTGAAGCATCACATAACTCGAGTTATGTGATGCTTCAAATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000584.2-153s1c1
Sequence:CCGGGCTCTGTGTGAAGGTGCAGTTCTCGAGAACTGCACCTTCACACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-674s21c1
Sequence:CCGGTGCACGGGAGAATATACAAATCTCGAGATTTGTATATTCTCCCGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-465s21c1
Sequence:CCGGTACTTCAACACTTCATGTATTCTCGAGAATACATGAAGTGTTGAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-518s21c1
Sequence:CCGGTACAAGATTCCTGGTTAAATTCTCGAGAATTTAACCAGGAATCTTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-810s21c1
Sequence:CCGGTTGCCATAAAGTCAAATTTAGCTCGAGCTAAATTTGACTTTATGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-716s21c1
Sequence:CCGGCAAGAGAATATCCGAACTTTACTCGAGTAAAGTTCGGATATTCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000584.2-282s21c1
Sequence:CCGGTGCGCCAACACAGAAATTATTCTCGAGAATAATTTCTGTGTTGGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000584.2-251s21c1
Sequence:CCGGAGAACTGAGAGTGATTGAGAGCTCGAGCTCTCAATCACTCTCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_000584.2-194s21c1
Sequence:CCGGACTTAGATGTCAGTGCATAAACTCGAGTTTATGCACTGACATCTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-583s21c1
Sequence:CCGGTATCCAGAACATACTTATATGCTCGAGCATATAAGTATGTTCTGGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000584
VALIDATED
IL8 MISSION shRNA Lentiviral Transduction Particles
interleukin 8
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000584.2-281s1c1
Sequence:CCGGCTGCGCCAACACAGAAATTATCTCGAGATAATTTCTGTGTTGGCGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_000584.2-727s1c1
Sequence:CCGGCCGAACTTTAATTTCAGGAATCTCGAGATTCCTGAAATTAAAGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000584.2-178s1c1
Sequence:CCGGCAAGGAGTGCTAAAGAACTTACTCGAGTAAGTTCTTTAGCACTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000584.2-285s1c1
Sequence:CCGGGCCAACACAGAAATTATTGTACTCGAGTACAATAATTTCTGTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-727s21c1
Sequence:CCGGCCGAACTTTAATTTCAGGAATCTCGAGATTCCTGAAATTAAAGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000584.2-129s21c1
Sequence:CCGGTTGGCAGCCTTCCTGATTTCTCTCGAGAGAAATCAGGAAGGCTGCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-769s21c1
Sequence:CCGGGATATTTGAAGCATCACATAACTCGAGTTATGTGATGCTTCAAATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000584.2-153s1c1
Sequence:CCGGGCTCTGTGTGAAGGTGCAGTTCTCGAGAACTGCACCTTCACACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-674s21c1
Sequence:CCGGTGCACGGGAGAATATACAAATCTCGAGATTTGTATATTCTCCCGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-465s21c1
Sequence:CCGGTACTTCAACACTTCATGTATTCTCGAGAATACATGAAGTGTTGAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-518s21c1
Sequence:CCGGTACAAGATTCCTGGTTAAATTCTCGAGAATTTAACCAGGAATCTTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-810s21c1
Sequence:CCGGTTGCCATAAAGTCAAATTTAGCTCGAGCTAAATTTGACTTTATGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-716s21c1
Sequence:CCGGCAAGAGAATATCCGAACTTTACTCGAGTAAAGTTCGGATATTCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000584.2-282s21c1
Sequence:CCGGTGCGCCAACACAGAAATTATTCTCGAGAATAATTTCTGTGTTGGCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000584.2-251s21c1
Sequence:CCGGAGAACTGAGAGTGATTGAGAGCTCGAGCTCTCAATCACTCTCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_000584.2-194s21c1
Sequence:CCGGACTTAGATGTCAGTGCATAAACTCGAGTTTATGCACTGACATCTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000584.2-583s21c1
Sequence:CCGGTATCCAGAACATACTTATATGCTCGAGCATATAAGTATGTTCTGGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)