EMAIL THIS PAGE TO A FRIEND

IL9

interleukin 9

59 Gene Product Result for
Synonyms: HP40 IL-9 P40
UniProtKB ID: P15248
Gene ID:
Human(3578) Summary: The protein encoded by this gene is a cytokine that acts as a regulator of a variety of hematopoietic cells. This cytokine stimulates cell proliferation and prevents apoptosis. It functions through the interleukin 9 receptor (IL9R), which activates different signal transducer and activator (STAT) proteins and thus connects this cytokine to various biological processes. The gene encoding this cytokine has been identified as a candidate gene for asthma. Genetic studies on a mouse model of asthma demonstrated that this cytokine is a determining factor in the pathogenesis of bronchial hyperresponsiveness. [provided by RefSeq, Jul 2008]
Mouse(16198) interleukin 9
Rat(116558) interleukin 9
chicken(416307) interleukin 9
dog(100682918) interleukin 9
domestic cat(101088458) interleukin 9
cow(613392) interleukin 9
sheep(101105494) interleukin 9
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000590 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000590 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000590 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008373 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008373 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008373 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154791 MISSION® esiRNA esiRNA human IL9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000590 Rosetta Predictions human pricing
NM_001105747 Rosetta Predictions rat pricing
NM_008373 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246941 predicted 359
2 SASI_Hs01_00246942 predicted 230
3 SASI_Hs01_00246943 predicted 357
4 SASI_Hs01_00246944 predicted 362
5 SASI_Hs01_00246945 predicted 200
6 SASI_Hs02_00302860 predicted 352
7 SASI_Hs01_00246946 predicted 357
8 SASI_Hs01_00246947 predicted 215
9 SASI_Hs02_00302861 predicted 235
10 SASI_Hs01_00246948 predicted 197
11 SASI_Hs01_00246949 predicted 301
12 SASI_Hs01_00246950 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105747 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212136 predicted 231
2 SASI_Rn02_00212137 predicted 319
3 SASI_Rn02_00212138 predicted 195
4 SASI_Rn02_00212139 predicted 251
5 SASI_Rn02_00212140 predicted 255
6 SASI_Rn02_00212141 predicted 222
7 SASI_Rn02_00212142 predicted 255
8 SASI_Rn02_00212143 predicted 218
9 SASI_Rn02_00212144 predicted 251
10 SASI_Rn02_00212145 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008373 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100108 predicted 239
2 SASI_Mm01_00100109 predicted 241
3 SASI_Mm01_00100110 predicted 222
4 SASI_Mm01_00100111 predicted 214
5 SASI_Mm01_00100112 predicted 290
6 SASI_Mm01_00100113 predicted 214
7 SASI_Mm01_00100114 predicted 294
8 SASI_Mm01_00100115 predicted 236
9 SASI_Mm01_00100116 predicted 231
10 SASI_Mm01_00100117 predicted 238
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000590
IL9 MISSION shRNA Bacterial Glycerol Stock
interleukin 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000590.1-181s21c1
Sequence:CCGGTGGGCATTCCCTCTGACAACTCTCGAGAGTTGTCAGAGGGAATGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000590.1-119s21c1
Sequence:CCGGGATGCAGGAAGATCCAGCTTCCTCGAGGAAGCTGGATCTTCCTGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000590.1-246s21c1
Sequence:CCGGACCACCATGCAAACAAGATACCTCGAGGTATCTTGTTTGCATGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000590.1-151s1c1
Sequence:CCGGGCAGTGCTAATGTGACCAGTTCTCGAGAACTGGTCACATTAGCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000590.1-384s1c1
Sequence:CCGGCTGAAGAGTCTTCTGGAAATTCTCGAGAATTTCCAGAAGACTCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000590.1-311s1c1
Sequence:CCGGGAACAACAAGTGTCCATATTTCTCGAGAAATATGGACACTTGTTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000590.1-424s1c1
Sequence:CCGGGAGGGATGAGAGGCAAGATATCTCGAGATATCTTGCCTCTCATCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000590.1-92s1c1
Sequence:CCGGCCTGGACATCAACTTCCTCATCTCGAGATGAGGAAGTTGATGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000590
IL9 MISSION shRNA shRNA Plasmid DNA
interleukin 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000590.1-181s21c1
Sequence:CCGGTGGGCATTCCCTCTGACAACTCTCGAGAGTTGTCAGAGGGAATGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000590.1-119s21c1
Sequence:CCGGGATGCAGGAAGATCCAGCTTCCTCGAGGAAGCTGGATCTTCCTGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000590.1-246s21c1
Sequence:CCGGACCACCATGCAAACAAGATACCTCGAGGTATCTTGTTTGCATGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000590.1-151s1c1
Sequence:CCGGGCAGTGCTAATGTGACCAGTTCTCGAGAACTGGTCACATTAGCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000590.1-384s1c1
Sequence:CCGGCTGAAGAGTCTTCTGGAAATTCTCGAGAATTTCCAGAAGACTCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000590.1-311s1c1
Sequence:CCGGGAACAACAAGTGTCCATATTTCTCGAGAAATATGGACACTTGTTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000590.1-424s1c1
Sequence:CCGGGAGGGATGAGAGGCAAGATATCTCGAGATATCTTGCCTCTCATCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000590.1-92s1c1
Sequence:CCGGCCTGGACATCAACTTCCTCATCTCGAGATGAGGAAGTTGATGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000590
IL9 MISSION shRNA Lentiviral Transduction Particles
interleukin 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000590.1-181s21c1
Sequence:CCGGTGGGCATTCCCTCTGACAACTCTCGAGAGTTGTCAGAGGGAATGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000590.1-119s21c1
Sequence:CCGGGATGCAGGAAGATCCAGCTTCCTCGAGGAAGCTGGATCTTCCTGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000590.1-246s21c1
Sequence:CCGGACCACCATGCAAACAAGATACCTCGAGGTATCTTGTTTGCATGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000590.1-151s1c1
Sequence:CCGGGCAGTGCTAATGTGACCAGTTCTCGAGAACTGGTCACATTAGCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000590.1-384s1c1
Sequence:CCGGCTGAAGAGTCTTCTGGAAATTCTCGAGAATTTCCAGAAGACTCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000590.1-311s1c1
Sequence:CCGGGAACAACAAGTGTCCATATTTCTCGAGAAATATGGACACTTGTTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000590.1-424s1c1
Sequence:CCGGGAGGGATGAGAGGCAAGATATCTCGAGATATCTTGCCTCTCATCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000590.1-92s1c1
Sequence:CCGGCCTGGACATCAACTTCCTCATCTCGAGATGAGGAAGTTGATGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008373
IL9 MISSION shRNA Bacterial Glycerol Stock
interleukin 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008373.1-188s1c1
Sequence:CCGGCCGTCCCAACTGATGATTGTACTCGAGTACAATCATCAGTTGGGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008373.1-245s1c1
Sequence:CCGGCCAATGCCACACAGAAATCAACTCGAGTTGATTTCTGTGTGGCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008373.1-125s1c1
Sequence:CCGGTGAAGGATGATCCACCGTCAACTCGAGTTGACGGTGGATCATCCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008373.1-100s1c1
Sequence:CCGGGACACCAATTACCTTATTGAACTCGAGTTCAATAAGGTAATTGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008373.1-367s1c1
Sequence:CCGGGCAGGCAACACACTGTCATTTCTCGAGAAATGACAGTGTGTTGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008373
IL9 MISSION shRNA shRNA Plasmid DNA
interleukin 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008373.1-188s1c1
Sequence:CCGGCCGTCCCAACTGATGATTGTACTCGAGTACAATCATCAGTTGGGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008373.1-245s1c1
Sequence:CCGGCCAATGCCACACAGAAATCAACTCGAGTTGATTTCTGTGTGGCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008373.1-125s1c1
Sequence:CCGGTGAAGGATGATCCACCGTCAACTCGAGTTGACGGTGGATCATCCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008373.1-100s1c1
Sequence:CCGGGACACCAATTACCTTATTGAACTCGAGTTCAATAAGGTAATTGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008373.1-367s1c1
Sequence:CCGGGCAGGCAACACACTGTCATTTCTCGAGAAATGACAGTGTGTTGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008373
IL9 MISSION shRNA Lentiviral Transduction Particles
interleukin 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008373.1-188s1c1
Sequence:CCGGCCGTCCCAACTGATGATTGTACTCGAGTACAATCATCAGTTGGGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008373.1-245s1c1
Sequence:CCGGCCAATGCCACACAGAAATCAACTCGAGTTGATTTCTGTGTGGCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008373.1-125s1c1
Sequence:CCGGTGAAGGATGATCCACCGTCAACTCGAGTTGACGGTGGATCATCCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008373.1-100s1c1
Sequence:CCGGGACACCAATTACCTTATTGAACTCGAGTTCAATAAGGTAATTGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008373.1-367s1c1
Sequence:CCGGGCAGGCAACACACTGTCATTTCTCGAGAAATGACAGTGTGTTGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)