EMAIL THIS PAGE TO A FRIEND

IL9R

interleukin 9 receptor

86 Gene Product Result for
Synonyms: CD129 IL-9R
UniProtKB ID: Q01113, B9ZVT0, Q14634, Q8WWU1, Q96TF0
Gene ID:
Human(3581) Summary: The protein encoded by this gene is a cytokine receptor that specifically mediates the biological effects of interleukin 9 (IL9). The functional IL9 receptor complex requires this protein as well as the interleukin 2 receptor, gamma (IL2RG), a common gamma subunit shared by the receptors of many different cytokines. The ligand binding of this receptor leads to the activation of various JAK kinases and STAT proteins, which connect to different biologic responses. This gene is located at the pseudoautosomal regions of X and Y chromosomes. Genetic studies suggested an association of this gene with the development of asthma. Multiple pseudogenes on chromosome 9, 10, 16, and 18 have been described. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16199) interleukin 9 receptor
Rat(24500) interleukin 9 receptor
chicken(416587) interleukin 9 receptor
domestic cat(101098275) interleukin 9 receptor
cow(618294) interleukin 9 receptor
Horse(100066258) interleukin 9 receptor
dog(611642) interleukin 9 receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1531 Human IL-9 R ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008374 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008374 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008374 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002186 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002186 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002186 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002186 Rosetta Predictions human pricing
NM_176786 Rosetta Predictions human pricing
NM_017021 Rosetta Predictions rat pricing
NM_008374 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095418 predicted 1800
2 SASI_Hs01_00095419 predicted 1849
3 SASI_Hs01_00095420 predicted 1752
4 SASI_Hs01_00095421 predicted 1756
5 SASI_Hs01_00095422 predicted 1723
6 SASI_Hs01_00095423 predicted 1846
7 SASI_Hs01_00095424 predicted 1744
8 SASI_Hs01_00095425 predicted 1799
9 SASI_Hs01_00095426 predicted 1714
10 SASI_Hs01_00095427 predicted 1797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014000 predicted 806
2 SASI_Hs01_00014001 predicted 1389
3 SASI_Hs01_00014002 predicted 877
4 SASI_Hs02_00369211 predicted 200
5 SASI_Hs01_00014003 predicted 1074
6 SASI_Hs01_00014004 predicted 789
7 SASI_Hs02_00369212 predicted 983
8 SASI_Hs01_00014006 predicted 620
9 SASI_Hs02_00369213 predicted 474
10 SASI_Hs01_00014007 predicted 972
11 SASI_Hs01_00014005 predicted 349
12 SASI_Hs01_00014008 predicted 1368
13 SASI_Hs01_00014009 predicted 1042
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017021 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085770 predicted 1409
2 SASI_Rn01_00085771 predicted 858
3 SASI_Rn01_00085772 predicted 532
4 SASI_Rn01_00085773 predicted 868
5 SASI_Rn02_00261189 predicted 327
6 SASI_Rn01_00085774 predicted 1430
7 SASI_Rn01_00085775 predicted 612
8 SASI_Rn01_00085776 predicted 1482
9 SASI_Rn01_00085777 predicted 644
10 SASI_Rn01_00085778 predicted 332
11 SASI_Rn01_00085779 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137084 predicted 520
2 SASI_Mm01_00137085 predicted 251
3 SASI_Mm01_00137086 predicted 687
4 SASI_Mm01_00137087 predicted 447
5 SASI_Mm01_00137088 predicted 1010
6 SASI_Mm01_00137089 predicted 250
7 SASI_Mm01_00137090 predicted 253
8 SASI_Mm01_00137092 predicted 819
9 SASI_Mm01_00137093 predicted 498
10 SASI_Mm02_00313737 predicted 1008
11 SASI_Mm01_00137091 predicted 1435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008374
IL9R MISSION shRNA Bacterial Glycerol Stock
interleukin 9 receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008374.1-1971s1c1
Sequence:CCGGCGACTGATTCAAAGAAGTCTTCTCGAGAAGACTTCTTTGAATCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008374.1-320s1c1
Sequence:CCGGCCTAAAGAGGAGGTGTTCTTACTCGAGTAAGAACACCTCCTCTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008374.1-940s1c1
Sequence:CCGGCCATCCTCTCTACAGTGTGTACTCGAGTACACACTGTAGAGAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008374.1-163s1c1
Sequence:CCGGCACCTGTCTCAGCAACAGTATCTCGAGATACTGTTGCTGAGACAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008374.2-341s21c1
Sequence:CCGGTGCACCTTCTGGGACAGTATGCTCGAGCATACTGTCCCAGAAGGTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008374
IL9R MISSION shRNA shRNA Plasmid DNA
interleukin 9 receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008374.1-1971s1c1
Sequence:CCGGCGACTGATTCAAAGAAGTCTTCTCGAGAAGACTTCTTTGAATCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008374.1-320s1c1
Sequence:CCGGCCTAAAGAGGAGGTGTTCTTACTCGAGTAAGAACACCTCCTCTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008374.1-940s1c1
Sequence:CCGGCCATCCTCTCTACAGTGTGTACTCGAGTACACACTGTAGAGAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008374.1-163s1c1
Sequence:CCGGCACCTGTCTCAGCAACAGTATCTCGAGATACTGTTGCTGAGACAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008374.2-341s21c1
Sequence:CCGGTGCACCTTCTGGGACAGTATGCTCGAGCATACTGTCCCAGAAGGTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008374
IL9R MISSION shRNA Lentiviral Transduction Particles
interleukin 9 receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008374.1-1971s1c1
Sequence:CCGGCGACTGATTCAAAGAAGTCTTCTCGAGAAGACTTCTTTGAATCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008374.1-320s1c1
Sequence:CCGGCCTAAAGAGGAGGTGTTCTTACTCGAGTAAGAACACCTCCTCTTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008374.1-940s1c1
Sequence:CCGGCCATCCTCTCTACAGTGTGTACTCGAGTACACACTGTAGAGAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008374.1-163s1c1
Sequence:CCGGCACCTGTCTCAGCAACAGTATCTCGAGATACTGTTGCTGAGACAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008374.2-341s21c1
Sequence:CCGGTGCACCTTCTGGGACAGTATGCTCGAGCATACTGTCCCAGAAGGTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002186
IL9R MISSION shRNA Bacterial Glycerol Stock
interleukin 9 receptor
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002186.2-449s1c1
Sequence:CCGGCGGCACACATAAGTGCATCTTCTCGAGAAGATGCACTTATGTGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002186.2-512s1c1
Sequence:CCGGGCTCGTGCCATCTGACAATTTCTCGAGAAATTGTCAGATGGCACGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002186.2-885s1c1
Sequence:CCGGGTAGAGGAGGAGCGTTATACACTCGAGTGTATAACGCTCCTCCTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002186.2-626s1c1
Sequence:CCGGGCCCTCTGACTTGCAGAGCAACTCGAGTTGCTCTGCAAGTCAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002186.2-518s1c1
Sequence:CCGGGCCATCTGACAATTTCACCATCTCGAGATGGTGAAATTGTCAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002186
IL9R MISSION shRNA shRNA Plasmid DNA
interleukin 9 receptor
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002186.2-449s1c1
Sequence:CCGGCGGCACACATAAGTGCATCTTCTCGAGAAGATGCACTTATGTGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002186.2-512s1c1
Sequence:CCGGGCTCGTGCCATCTGACAATTTCTCGAGAAATTGTCAGATGGCACGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002186.2-885s1c1
Sequence:CCGGGTAGAGGAGGAGCGTTATACACTCGAGTGTATAACGCTCCTCCTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002186.2-626s1c1
Sequence:CCGGGCCCTCTGACTTGCAGAGCAACTCGAGTTGCTCTGCAAGTCAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002186.2-518s1c1
Sequence:CCGGGCCATCTGACAATTTCACCATCTCGAGATGGTGAAATTGTCAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002186
IL9R MISSION shRNA Lentiviral Transduction Particles
interleukin 9 receptor
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002186.2-449s1c1
Sequence:CCGGCGGCACACATAAGTGCATCTTCTCGAGAAGATGCACTTATGTGTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002186.2-512s1c1
Sequence:CCGGGCTCGTGCCATCTGACAATTTCTCGAGAAATTGTCAGATGGCACGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002186.2-885s1c1
Sequence:CCGGGTAGAGGAGGAGCGTTATACACTCGAGTGTATAACGCTCCTCCTCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002186.2-626s1c1
Sequence:CCGGGCCCTCTGACTTGCAGAGCAACTCGAGTTGCTCTGCAAGTCAGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002186.2-518s1c1
Sequence:CCGGGCCATCTGACAATTTCACCATCTCGAGATGGTGAAATTGTCAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)