EMAIL THIS PAGE TO A FRIEND

ILDR1

immunoglobulin-like domain containing receptor 1

126 Gene Product Result for
Synonyms: DFNB42 ILDR1alpha ILDR1alpha' ILDR1beta
UniProtKB ID: Q86SU0, Q6ZP61, Q7Z578
Gene ID:
Human(286676) Summary: This gene encodes a protein that contains an immunoglobulin-like domain. The encoded protein may function as a multimeric receptor at the cell surface. The expression of this gene may be a diagnostic marker for cancer progression. Alternatively spliced transcript variants encoding multiple protein isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Mouse(106347) immunoglobulin-like domain containing receptor 1
Rat(303914) immunoglobulin-like domain containing receptor 1
chicken(418358) immunoglobulin-like domain containing receptor 1
domestic cat(101090132) immunoglobulin-like domain containing receptor 1
cow(538495) immunoglobulin-like domain containing receptor 1
dog(608570) immunoglobulin-like domain containing receptor 1
sheep(101112275) immunoglobulin-like domain containing receptor 1
domestic guinea pig(100724567) immunoglobulin-like domain containing receptor 1
naked mole-rat(101723491) immunoglobulin-like domain containing receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175924 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175924 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175924 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134109 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134109 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134109 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175924 Rosetta Predictions human pricing
NM_001127536 Rosetta Predictions rat pricing
NM_134109 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025907 predicted 329
2 SASI_Hs01_00025909 predicted 298
3 SASI_Hs01_00025910 predicted 1144
4 SASI_Hs01_00025912 predicted 265
5 SASI_Hs01_00025913 predicted 305
6 SASI_Hs01_00025914 predicted 1010
7 SASI_Hs01_00025915 predicted 610
8 SASI_Hs01_00025916 predicted 1552
9 SASI_Hs02_00369181 predicted 1194
10 SASI_Hs02_00369182 predicted 815
11 SASI_Hs01_00025908 predicted 684
12 SASI_Hs01_00025911 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254113 predicted 1793
2 SASI_Rn02_00254114 predicted 262
3 SASI_Rn02_00254115 predicted 820
4 SASI_Rn02_00254116 predicted 1206
5 SASI_Rn02_00254117 predicted 1779
6 SASI_Rn02_00254118 predicted 437
7 SASI_Rn02_00254119 predicted 250
8 SASI_Rn02_00254120 predicted 1487
9 SASI_Rn02_00254121 predicted 347
10 SASI_Rn02_00254122 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134109 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339339 predicted 582
2 SASI_Mm01_00169625 predicted 850
3 SASI_Mm01_00169626 predicted 1678
4 SASI_Mm01_00169627 predicted 531
5 SASI_Mm01_00169628 predicted 1719
6 SASI_Mm01_00169629 predicted 383
7 SASI_Mm01_00169630 predicted 279
8 SASI_Mm01_00169631 predicted 1036
9 SASI_Mm01_00169633 predicted 1382
10 SASI_Mm01_00169634 predicted 1696
11 SASI_Mm01_00169632 predicted 963
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175924
ILDR1 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin-like domain containing receptor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175924.2-484s1c1
Sequence:CCGGCCGAGCAGATCTCGTGATAAACTCGAGTTTATCACGAGATCTGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175924.2-320s21c1
Sequence:CCGGGACTACTACTCAGCGTCATACCTCGAGGTATGACGCTGAGTAGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175924.2-200s1c1
Sequence:CCGGGAACGCTATGTCACCCTGTTTCTCGAGAAACAGGGTGACATAGCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175924.2-1529s1c1
Sequence:CCGGCCAGGCAAGAATAGCAGGAAACTCGAGTTTCCTGCTATTCTTGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175924.2-686s1c1
Sequence:CCGGCCTCAGTATTGCTGCTGCTATCTCGAGATAGCAGCAGCAATACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175924.2-819s1c1
Sequence:CCGGCCAATGGTGTCCTGGAGTATTCTCGAGAATACTCCAGGACACCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175924.2-2090s21c1
Sequence:CCGGAGTTAGAGTTCGAGGAATTACCTCGAGGTAATTCCTCGAACTCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175924.2-1768s21c1
Sequence:CCGGAGAGTTTGAGATTGGGTATAGCTCGAGCTATACCCAATCTCAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175924
ILDR1 MISSION shRNA shRNA Plasmid DNA
immunoglobulin-like domain containing receptor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175924.2-484s1c1
Sequence:CCGGCCGAGCAGATCTCGTGATAAACTCGAGTTTATCACGAGATCTGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175924.2-320s21c1
Sequence:CCGGGACTACTACTCAGCGTCATACCTCGAGGTATGACGCTGAGTAGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175924.2-200s1c1
Sequence:CCGGGAACGCTATGTCACCCTGTTTCTCGAGAAACAGGGTGACATAGCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175924.2-1529s1c1
Sequence:CCGGCCAGGCAAGAATAGCAGGAAACTCGAGTTTCCTGCTATTCTTGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175924.2-686s1c1
Sequence:CCGGCCTCAGTATTGCTGCTGCTATCTCGAGATAGCAGCAGCAATACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175924.2-819s1c1
Sequence:CCGGCCAATGGTGTCCTGGAGTATTCTCGAGAATACTCCAGGACACCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175924.2-2090s21c1
Sequence:CCGGAGTTAGAGTTCGAGGAATTACCTCGAGGTAATTCCTCGAACTCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175924.2-1768s21c1
Sequence:CCGGAGAGTTTGAGATTGGGTATAGCTCGAGCTATACCCAATCTCAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175924
ILDR1 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin-like domain containing receptor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175924.2-484s1c1
Sequence:CCGGCCGAGCAGATCTCGTGATAAACTCGAGTTTATCACGAGATCTGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175924.2-320s21c1
Sequence:CCGGGACTACTACTCAGCGTCATACCTCGAGGTATGACGCTGAGTAGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175924.2-200s1c1
Sequence:CCGGGAACGCTATGTCACCCTGTTTCTCGAGAAACAGGGTGACATAGCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175924.2-1529s1c1
Sequence:CCGGCCAGGCAAGAATAGCAGGAAACTCGAGTTTCCTGCTATTCTTGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175924.2-686s1c1
Sequence:CCGGCCTCAGTATTGCTGCTGCTATCTCGAGATAGCAGCAGCAATACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175924.2-819s1c1
Sequence:CCGGCCAATGGTGTCCTGGAGTATTCTCGAGAATACTCCAGGACACCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175924.2-2090s21c1
Sequence:CCGGAGTTAGAGTTCGAGGAATTACCTCGAGGTAATTCCTCGAACTCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175924.2-1768s21c1
Sequence:CCGGAGAGTTTGAGATTGGGTATAGCTCGAGCTATACCCAATCTCAAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134109
ILDR1 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin-like domain containing receptor 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000454971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134109.1-2054s21c1
Sequence:CCGGAGGAAACCTATGGAATATTATCTCGAGATAATATTCCATAGGTTTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134109.1-1028s21c1
Sequence:CCGGTGCGGATCTCAGAGCCAAATCCTCGAGGATTTGGCTCTGAGATCCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134109.1-965s21c1
Sequence:CCGGTAATGGTGTCCTGGAATATTTCTCGAGAAATATTCCAGGACACCATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134109.1-989s1c1
Sequence:CCGGGAAAGAATTGCGGAACCTCAACTCGAGTTGAGGTTCCGCAATTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134109.1-1673s21c1
Sequence:CCGGGTGGACGGAGTGTGGTCATTTCTCGAGAAATGACCACACTCCGTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134109.1-2394s1c1
Sequence:CCGGCCATCCAGTATAAACAAGAAACTCGAGTTTCTTGTTTATACTGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134109.1-498s1c1
Sequence:CCGGCGAGCAGATCTTGTGATTAATCTCGAGATTAATCACAAGATCTGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181946    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134109.1-2267s1c1
Sequence:CCGGGCAGTTGTTCACCAACCATATCTCGAGATATGGTTGGTGAACAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134109.1-532s1c1
Sequence:CCGGGGGATCATGGAGTATACTATTCTCGAGAATAGTATACTCCATGATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134109.1-701s1c1
Sequence:CCGGGCAGTATTGCTGCTGCTATATCTCGAGATATAGCAGCAGCAATACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134109.1-2278s1c1
Sequence:CCGGCCAACCATATTCTTGCTTCTTCTCGAGAAGAAGCAAGAATATGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134109.1-963s1c1
Sequence:CCGGGCTAATGGTGTCCTGGAATATCTCGAGATATTCCAGGACACCATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134109
ILDR1 MISSION shRNA shRNA Plasmid DNA
immunoglobulin-like domain containing receptor 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000454971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134109.1-2054s21c1
Sequence:CCGGAGGAAACCTATGGAATATTATCTCGAGATAATATTCCATAGGTTTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134109.1-1028s21c1
Sequence:CCGGTGCGGATCTCAGAGCCAAATCCTCGAGGATTTGGCTCTGAGATCCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134109.1-965s21c1
Sequence:CCGGTAATGGTGTCCTGGAATATTTCTCGAGAAATATTCCAGGACACCATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134109.1-989s1c1
Sequence:CCGGGAAAGAATTGCGGAACCTCAACTCGAGTTGAGGTTCCGCAATTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134109.1-1673s21c1
Sequence:CCGGGTGGACGGAGTGTGGTCATTTCTCGAGAAATGACCACACTCCGTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134109.1-2394s1c1
Sequence:CCGGCCATCCAGTATAAACAAGAAACTCGAGTTTCTTGTTTATACTGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134109.1-498s1c1
Sequence:CCGGCGAGCAGATCTTGTGATTAATCTCGAGATTAATCACAAGATCTGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181946    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134109.1-2267s1c1
Sequence:CCGGGCAGTTGTTCACCAACCATATCTCGAGATATGGTTGGTGAACAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134109.1-532s1c1
Sequence:CCGGGGGATCATGGAGTATACTATTCTCGAGAATAGTATACTCCATGATCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134109.1-701s1c1
Sequence:CCGGGCAGTATTGCTGCTGCTATATCTCGAGATATAGCAGCAGCAATACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134109.1-2278s1c1
Sequence:CCGGCCAACCATATTCTTGCTTCTTCTCGAGAAGAAGCAAGAATATGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134109.1-963s1c1
Sequence:CCGGGCTAATGGTGTCCTGGAATATCTCGAGATATTCCAGGACACCATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134109
ILDR1 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin-like domain containing receptor 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000454971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134109.1-2054s21c1
Sequence:CCGGAGGAAACCTATGGAATATTATCTCGAGATAATATTCCATAGGTTTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134109.1-1028s21c1
Sequence:CCGGTGCGGATCTCAGAGCCAAATCCTCGAGGATTTGGCTCTGAGATCCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134109.1-965s21c1
Sequence:CCGGTAATGGTGTCCTGGAATATTTCTCGAGAAATATTCCAGGACACCATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134109.1-989s1c1
Sequence:CCGGGAAAGAATTGCGGAACCTCAACTCGAGTTGAGGTTCCGCAATTCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134109.1-1673s21c1
Sequence:CCGGGTGGACGGAGTGTGGTCATTTCTCGAGAAATGACCACACTCCGTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134109.1-2394s1c1
Sequence:CCGGCCATCCAGTATAAACAAGAAACTCGAGTTTCTTGTTTATACTGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134109.1-498s1c1
Sequence:CCGGCGAGCAGATCTTGTGATTAATCTCGAGATTAATCACAAGATCTGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181946    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134109.1-2267s1c1
Sequence:CCGGGCAGTTGTTCACCAACCATATCTCGAGATATGGTTGGTGAACAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134109.1-532s1c1
Sequence:CCGGGGGATCATGGAGTATACTATTCTCGAGAATAGTATACTCCATGATCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134109.1-701s1c1
Sequence:CCGGGCAGTATTGCTGCTGCTATATCTCGAGATATAGCAGCAGCAATACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134109.1-2278s1c1
Sequence:CCGGCCAACCATATTCTTGCTTCTTCTCGAGAAGAAGCAAGAATATGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134109.1-963s1c1
Sequence:CCGGGCTAATGGTGTCCTGGAATATCTCGAGATATTCCAGGACACCATTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)