EMAIL THIS PAGE TO A FRIEND

ILDR2

immunoglobulin-like domain containing receptor 2

95 Gene Product Result for
Synonyms: C1orf32 RP4-782G3.2 dJ782G3.1
UniProtKB ID: Q71H61
Gene ID:
Mouse(100039795) immunoglobulin-like domain containing receptor 2
Rat(685277) immunoglobulin-like domain containing receptor 2
Zebrafish(564738) immunoglobulin-like domain containing receptor 2
cow(522946) immunoglobulin-like domain containing receptor 2
domestic cat(101101280) immunoglobulin-like domain containing receptor 2
dog(490364) immunoglobulin-like domain containing receptor 2
chicken(418447) immunoglobulin-like domain containing receptor 2
domestic guinea pig(100734809) immunoglobulin-like domain containing receptor 2
naked mole-rat(101721453) immunoglobulin-like domain containing receptor 2
sheep(101110204) immunoglobulin-like domain containing receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA012545 Anti-ILDR2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199351 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199351 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199351 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU153401 MISSION® esiRNA esiRNA targeting mouse Ildr2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199351 Rosetta Predictions human pricing
XM_001063122 Rosetta Predictions rat pricing
XM_001473525 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228125 predicted 477
2 SASI_Hs01_00228126 predicted 473
3 SASI_Hs01_00228127 predicted 1167
4 SASI_Hs01_00228128 predicted 280
5 SASI_Hs01_00228129 predicted 971
6 SASI_Hs01_00228130 predicted 1087
7 SASI_Hs01_00228131 predicted 419
8 SASI_Hs01_00228132 predicted 975
9 SASI_Hs01_00228133 predicted 417
10 SASI_Hs02_00372791 predicted 345
11 SASI_Hs01_00228124 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063122 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305899 predicted 385
2 SASI_Rn02_00305900 predicted 401
3 SASI_Rn02_00305901 predicted 937
4 SASI_Rn02_00305902 predicted 825
5 SASI_Rn02_00305903 predicted 1130
6 SASI_Rn02_00305904 predicted 440
7 SASI_Rn02_00305905 predicted 220
8 SASI_Rn02_00305906 predicted 1309
9 SASI_Rn02_00305907 predicted 1073
10 SASI_Rn02_00305908 predicted 1949
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473525 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00368745 predicted 1515
2 SASI_Mm02_00368746 predicted 861
3 SASI_Mm02_00368747 predicted 1665
4 SASI_Mm02_00368748 predicted 2381
5 SASI_Mm02_00368749 predicted 1477
6 SASI_Mm02_00368750 predicted 1360
7 SASI_Mm02_00368751 predicted 645
8 SASI_Mm02_00368752 predicted 797
9 SASI_Mm02_00368753 predicted 1498
10 SASI_Mm02_00368754 predicted 2008
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199351
ILDR2 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin-like domain containing receptor 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199351.1-2331s21c1
Sequence:CCGGATTGCCTATGCCTACAATATGCTCGAGCATATTGTAGGCATAGGCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199351.1-1095s21c1
Sequence:CCGGAGCAATTTCCGCCAGTCTTTCCTCGAGGAAAGACTGGCGGAAATTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199351.1-2178s1c1
Sequence:CCGGGCTTACCAAGAAAGCAAGAATCTCGAGATTCTTGCTTTCTTGGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199351.1-2191s1c1
Sequence:CCGGGCAAGAATGTGTGAGAACATTCTCGAGAATGTTCTCACACATTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199351.1-1045s1c1
Sequence:CCGGGCAGATATAACAACACCATCTCTCGAGAGATGGTGTTGTTATATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199351.1-475s1c1
Sequence:CCGGGCGGACTCTATTACTGTATTACTCGAGTAATACAGTAATAGAGTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199351.1-218s1c1
Sequence:CCGGGCAGTGGAAGTTCAAGTCCTACTCGAGTAGGACTTGAACTTCCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199351.1-1970s21c1
Sequence:CCGGGGTCTGATGTTGTCAACATTTCTCGAGAAATGTTGACAACATCAGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199351.1-1080s1c1
Sequence:CCGGCTACATGAGGAGGACAGCAATCTCGAGATTGCTGTCCTCCTCATGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199351.1-981s21c1
Sequence:CCGGATGAAGGTCCTGTACTATGTTCTCGAGAACATAGTACAGGACCTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199351.1-294s1c1
Sequence:CCGGCTCAGCAAGAGAAACCTGGAACTCGAGTTCCAGGTTTCTCTTGCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199351
ILDR2 MISSION shRNA shRNA Plasmid DNA
immunoglobulin-like domain containing receptor 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199351.1-2331s21c1
Sequence:CCGGATTGCCTATGCCTACAATATGCTCGAGCATATTGTAGGCATAGGCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199351.1-1095s21c1
Sequence:CCGGAGCAATTTCCGCCAGTCTTTCCTCGAGGAAAGACTGGCGGAAATTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199351.1-2178s1c1
Sequence:CCGGGCTTACCAAGAAAGCAAGAATCTCGAGATTCTTGCTTTCTTGGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199351.1-2191s1c1
Sequence:CCGGGCAAGAATGTGTGAGAACATTCTCGAGAATGTTCTCACACATTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199351.1-1045s1c1
Sequence:CCGGGCAGATATAACAACACCATCTCTCGAGAGATGGTGTTGTTATATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199351.1-475s1c1
Sequence:CCGGGCGGACTCTATTACTGTATTACTCGAGTAATACAGTAATAGAGTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199351.1-218s1c1
Sequence:CCGGGCAGTGGAAGTTCAAGTCCTACTCGAGTAGGACTTGAACTTCCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199351.1-1970s21c1
Sequence:CCGGGGTCTGATGTTGTCAACATTTCTCGAGAAATGTTGACAACATCAGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199351.1-1080s1c1
Sequence:CCGGCTACATGAGGAGGACAGCAATCTCGAGATTGCTGTCCTCCTCATGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199351.1-981s21c1
Sequence:CCGGATGAAGGTCCTGTACTATGTTCTCGAGAACATAGTACAGGACCTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199351.1-294s1c1
Sequence:CCGGCTCAGCAAGAGAAACCTGGAACTCGAGTTCCAGGTTTCTCTTGCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199351
ILDR2 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin-like domain containing receptor 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199351.1-2331s21c1
Sequence:CCGGATTGCCTATGCCTACAATATGCTCGAGCATATTGTAGGCATAGGCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199351.1-1095s21c1
Sequence:CCGGAGCAATTTCCGCCAGTCTTTCCTCGAGGAAAGACTGGCGGAAATTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199351.1-2178s1c1
Sequence:CCGGGCTTACCAAGAAAGCAAGAATCTCGAGATTCTTGCTTTCTTGGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199351.1-2191s1c1
Sequence:CCGGGCAAGAATGTGTGAGAACATTCTCGAGAATGTTCTCACACATTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199351.1-1045s1c1
Sequence:CCGGGCAGATATAACAACACCATCTCTCGAGAGATGGTGTTGTTATATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199351.1-475s1c1
Sequence:CCGGGCGGACTCTATTACTGTATTACTCGAGTAATACAGTAATAGAGTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199351.1-218s1c1
Sequence:CCGGGCAGTGGAAGTTCAAGTCCTACTCGAGTAGGACTTGAACTTCCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199351.1-1970s21c1
Sequence:CCGGGGTCTGATGTTGTCAACATTTCTCGAGAAATGTTGACAACATCAGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199351.1-1080s1c1
Sequence:CCGGCTACATGAGGAGGACAGCAATCTCGAGATTGCTGTCCTCCTCATGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199351.1-981s21c1
Sequence:CCGGATGAAGGTCCTGTACTATGTTCTCGAGAACATAGTACAGGACCTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199351.1-294s1c1
Sequence:CCGGCTCAGCAAGAGAAACCTGGAACTCGAGTTCCAGGTTTCTCTTGCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)