EMAIL THIS PAGE TO A FRIEND

ILF3

interleukin enhancer binding factor 3, 90kDa

237 Gene Product Result for
Synonyms: CBTF DRBF DRBP76 MMP4 MPHOSPH4 MPP4 NF-AT-90 NF110 NF110b NF90 NF90a NF90b NFAR NFAR-1 NFAR2 TCP110 TCP80
Gene ID:
Human(3609) Summary: This gene encodes a double-stranded RNA (dsRNA) binding protein that complexes with other proteins, dsRNAs, small noncoding RNAs, and mRNAs to regulate gene expression and stabilize mRNAs. This protein was first discovered to be a subunit of the nuclear factor of activated T-cells (NFAT); a transcription factor required for T-cell expression of interleukin 2. NFAT is a heterodimer of 45 kDa and 90 kDa proteins, the larger of which is the product of this gene. These proteins have been shown to affect the redistribution of nuclear mRNA to the cytoplasm. Knockdown of NF45 or NF90 protein retards cell growth; possibly by inhibition of mRNA stabilization. In contrast, an isoform (NF110) of this gene that is predominantly restricted to the nucleus has only minor effects on cell growth when its levels are reduced. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Nov 2008]
Mouse(16201) interleukin enhancer binding factor 3
Rat(84472) interleukin enhancer binding factor 3
dog(484950) interleukin enhancer binding factor 3, 90kDa
domestic cat(101096038) interleukin enhancer binding factor 3, 90kDa
cow(614936) interleukin enhancer binding factor 3, 90kDa
Horse(100057707) interleukin enhancer binding factor 3, 90kDa
domestic guinea pig(100717410) interleukin enhancer binding factor 3, 90kDa
naked mole-rat(101723927) interleukin enhancer binding factor 3, 90kDa
sheep(101118785) interleukin enhancer binding factor 3, 90kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV38968 Anti-ILF3 (AB1) antibody produced in rabbit affinity isolated antibody guinea pig, bovine, zebrafish, rat, mouse, horse, canine, human, rabbit
immunohistochemistry, western blot pricing
AV40523 Anti-ILF3 (AB2) antibody produced in rabbit affinity isolated antibody rabbit, bovine, rat, mouse, guinea pig, human, horse
immunohistochemistry, western blot pricing
AV40522 Anti-ILF3 (AB3) antibody produced in rabbit affinity isolated antibody bovine, horse, human, rabbit, guinea pig
immunohistochemistry, western blot pricing
SAB1406034 Anti-ILF3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA001897 Anti-ILF3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV38969 Anti-ILF3 antibody produced in rabbit IgG fraction of antiserum human, rat, mouse, guinea pig, canine, horse, rabbit
western blot pricing
SAB2101154 Anti-ILF3 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, human, rat, horse, rabbit
immunohistochemistry, western blot pricing
SAB2106244 Anti-ILF3 antibody produced in rabbit affinity isolated antibody mouse, rabbit, horse, human, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004516 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004516 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004516 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010561 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010561 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010561 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004516 Rosetta Predictions human pricing
NM_012218 Rosetta Predictions human pricing
NM_153464 Rosetta Predictions human pricing
NM_053412 Rosetta Predictions rat pricing
NM_001042707 Rosetta Predictions mouse pricing
NM_001042708 Rosetta Predictions mouse pricing
NM_001042709 Rosetta Predictions mouse pricing
NM_010561 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242960 predicted 1294
2 SASI_Hs01_00242961 predicted 799
3 SASI_Hs01_00242962 predicted 1865
4 SASI_Hs01_00242963 predicted 1637
5 SASI_Hs01_00242964 predicted 1275
6 SASI_Hs01_00242965 predicted 308
7 SASI_Hs01_00242966 predicted 402
8 SASI_Hs01_00242967 predicted 752
9 SASI_Hs01_00242968 predicted 944
10 SASI_Hs01_00242969 predicted 1832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012218 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187686 predicted 1288
2 SASI_Hs01_00187687 predicted 803
3 SASI_Hs01_00187688 predicted 1859
4 SASI_Hs01_00187689 predicted 1636
5 SASI_Hs01_00187690 predicted 1280
6 SASI_Hs01_00187691 predicted 314
7 SASI_Hs01_00187692 predicted 400
8 SASI_Hs01_00187693 predicted 756
9 SASI_Hs01_00187694 predicted 943
10 SASI_Hs01_00187695 predicted 1838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093879 predicted 1289
2 SASI_Hs01_00093880 predicted 801
3 SASI_Hs01_00093881 predicted 1857
4 SASI_Hs01_00093882 predicted 1637
5 SASI_Hs01_00093883 predicted 1280
6 SASI_Hs01_00093884 predicted 311
7 SASI_Hs01_00093885 predicted 399
8 SASI_Hs01_00093886 predicted 750
9 SASI_Hs01_00093887 predicted 936
10 SASI_Hs01_00093888 predicted 1834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053412 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118926 predicted 429
2 SASI_Rn01_00118927 predicted 1798
3 SASI_Rn01_00118928 predicted 267
4 SASI_Rn01_00118929 predicted 1791
5 SASI_Rn01_00118931 predicted 892
6 SASI_Rn01_00118932 predicted 2051
7 SASI_Rn01_00118933 predicted 2505
8 SASI_Rn01_00118934 predicted 2895
9 SASI_Rn02_00265936 predicted 272
10 SASI_Rn01_00118935 predicted 1876
11 SASI_Rn01_00118930 predicted 1601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042707 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290965 predicted 1058
2 SASI_Mm02_00290966 predicted 1555
3 SASI_Mm02_00290967 predicted 1085
4 SASI_Mm02_00290968 predicted 862
5 SASI_Mm02_00290969 predicted 1293
6 SASI_Mm02_00290970 predicted 2023
7 SASI_Mm02_00290971 predicted 638
8 SASI_Mm02_00290972 predicted 744
9 SASI_Mm02_00290973 predicted 1884
10 SASI_Mm02_00290974 predicted 1852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042708 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290975 predicted 1095
2 SASI_Mm02_00290976 predicted 1601
3 SASI_Mm02_00290977 predicted 1121
4 SASI_Mm02_00290978 predicted 902
5 SASI_Mm02_00290979 predicted 1331
6 SASI_Mm02_00290980 predicted 2061
7 SASI_Mm02_00290981 predicted 674
8 SASI_Mm02_00290982 predicted 779
9 SASI_Mm02_00290983 predicted 1916
10 SASI_Mm02_00290984 predicted 1885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290985 predicted 1057
2 SASI_Mm02_00290986 predicted 1560
3 SASI_Mm02_00290987 predicted 1080
4 SASI_Mm02_00290988 predicted 866
5 SASI_Mm02_00290989 predicted 1292
6 SASI_Mm02_00290990 predicted 2026
7 SASI_Mm02_00290991 predicted 642
8 SASI_Mm02_00290992 predicted 742
9 SASI_Mm02_00290993 predicted 1885
10 SASI_Mm02_00290994 predicted 1847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010561 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318833 predicted 1097
2 SASI_Mm02_00318834 predicted 1598
3 SASI_Mm02_00318835 predicted 1124
4 SASI_Mm01_00114153 predicted 903
5 SASI_Mm02_00318836 predicted 1336
6 SASI_Mm01_00114159 predicted 2064
7 SASI_Mm01_00114160 predicted 672
8 SASI_Mm02_00318837 predicted 784
9 SASI_Mm02_00318838 predicted 1922
10 SASI_Mm02_00318839 predicted 1891
11 SASI_Mm01_00114151 predicted 621
12 SASI_Mm01_00114152 predicted 287
13 SASI_Mm01_00114154 predicted 210
14 SASI_Mm01_00114155 predicted 2982
15 SASI_Mm01_00114156 predicted 1782
16 SASI_Mm01_00114157 predicted 2534
17 SASI_Mm01_00114158 predicted 2917
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004516
VALIDATED
ILF3 MISSION shRNA Bacterial Glycerol Stock
interleukin enhancer binding factor 3, 90kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004516.2-2560s1c1
Sequence:CCGGGCCTTTGAACTTGGTCCTATTCTCGAGAATAGGACCAAGTTCAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004516.2-301s1c1
Sequence:CCGGGCCATGTGATGGCAAAGCATTCTCGAGAATGCTTTGCCATCACATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004516.2-1284s1c1
Sequence:CCGGCCTTCCAAGATGCCCAAGAAACTCGAGTTTCTTGGGCATCTTGGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004516.2-1121s1c1
Sequence:CCGGGCCAGATGGTTCTGGCATTTACTCGAGTAAATGCCAGAACCATCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004516.2-471s1c1
Sequence:CCGGCCAGAGGACGACAGTAAAGAACTCGAGTTCTTTACTGTCGTCCTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_004516.3-352s21c1
Sequence:CCGGGCCATGTGATGGCAAAGCATTCTCGAGAATGCTTTGCCATCACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004516.3-2416s21c1
Sequence:CCGGGGTCTTCCTAGAGCGTCTAAACTCGAGTTTAGACGCTCTAGGAAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004516.3-522s21c1
Sequence:CCGGCCAGAGGACGACAGTAAAGAACTCGAGTTCTTTACTGTCGTCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004516.3-2612s21c1
Sequence:CCGGCCTTTGAACTTGGTCCTATTGCTCGAGCAATAGGACCAAGTTCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004516.3-1335s21c1
Sequence:CCGGCCTTCCAAGATGCCCAAGAAACTCGAGTTTCTTGGGCATCTTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004516
VALIDATED
ILF3 MISSION shRNA shRNA Plasmid DNA
interleukin enhancer binding factor 3, 90kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004516.2-2560s1c1
Sequence:CCGGGCCTTTGAACTTGGTCCTATTCTCGAGAATAGGACCAAGTTCAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004516.2-301s1c1
Sequence:CCGGGCCATGTGATGGCAAAGCATTCTCGAGAATGCTTTGCCATCACATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004516.2-1284s1c1
Sequence:CCGGCCTTCCAAGATGCCCAAGAAACTCGAGTTTCTTGGGCATCTTGGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004516.2-1121s1c1
Sequence:CCGGGCCAGATGGTTCTGGCATTTACTCGAGTAAATGCCAGAACCATCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004516.2-471s1c1
Sequence:CCGGCCAGAGGACGACAGTAAAGAACTCGAGTTCTTTACTGTCGTCCTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_004516.3-352s21c1
Sequence:CCGGGCCATGTGATGGCAAAGCATTCTCGAGAATGCTTTGCCATCACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004516.3-2416s21c1
Sequence:CCGGGGTCTTCCTAGAGCGTCTAAACTCGAGTTTAGACGCTCTAGGAAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004516.3-522s21c1
Sequence:CCGGCCAGAGGACGACAGTAAAGAACTCGAGTTCTTTACTGTCGTCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004516.3-2612s21c1
Sequence:CCGGCCTTTGAACTTGGTCCTATTGCTCGAGCAATAGGACCAAGTTCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004516.3-1335s21c1
Sequence:CCGGCCTTCCAAGATGCCCAAGAAACTCGAGTTTCTTGGGCATCTTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004516
VALIDATED
ILF3 MISSION shRNA Lentiviral Transduction Particles
interleukin enhancer binding factor 3, 90kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004516.2-2560s1c1
Sequence:CCGGGCCTTTGAACTTGGTCCTATTCTCGAGAATAGGACCAAGTTCAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004516.2-301s1c1
Sequence:CCGGGCCATGTGATGGCAAAGCATTCTCGAGAATGCTTTGCCATCACATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004516.2-1284s1c1
Sequence:CCGGCCTTCCAAGATGCCCAAGAAACTCGAGTTTCTTGGGCATCTTGGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004516.2-1121s1c1
Sequence:CCGGGCCAGATGGTTCTGGCATTTACTCGAGTAAATGCCAGAACCATCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004516.2-471s1c1
Sequence:CCGGCCAGAGGACGACAGTAAAGAACTCGAGTTCTTTACTGTCGTCCTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_004516.3-352s21c1
Sequence:CCGGGCCATGTGATGGCAAAGCATTCTCGAGAATGCTTTGCCATCACATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004516.3-2416s21c1
Sequence:CCGGGGTCTTCCTAGAGCGTCTAAACTCGAGTTTAGACGCTCTAGGAAGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004516.3-522s21c1
Sequence:CCGGCCAGAGGACGACAGTAAAGAACTCGAGTTCTTTACTGTCGTCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004516.3-2612s21c1
Sequence:CCGGCCTTTGAACTTGGTCCTATTGCTCGAGCAATAGGACCAAGTTCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004516.3-1335s21c1
Sequence:CCGGCCTTCCAAGATGCCCAAGAAACTCGAGTTTCTTGGGCATCTTGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010561
VALIDATED
ILF3 MISSION shRNA Bacterial Glycerol Stock
interleukin enhancer binding factor 3, 90kDa
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010561.1-759s1c1
Sequence:CCGGCCCTGTTGTCAGAGAAGAAATCTCGAGATTTCTTCTCTGACAACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010561.1-370s1c1
Sequence:CCGGGCTGTCTCTGACTGGATTGATCTCGAGATCAATCCAGTCAGAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010561.1-1295s1c1
Sequence:CCGGCGGTGGACTACACTGTTCAAACTCGAGTTTGAACAGTGTAGTCCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010561.1-1809s1c1
Sequence:CCGGGCATGGCAAGAACCCTGTTATCTCGAGATAACAGGGTTCTTGCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010561.1-1966s1c1
Sequence:CCGGGCAAAGGCTTATGCTGCACTTCTCGAGAAGTGCAGCATAAGCCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010561.2-2973s21c1
Sequence:CCGGCCAACTTGTCTCGGGAGATTGCTCGAGCAATCTCCCGAGACAAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010561.2-1440s21c1
Sequence:CCGGGAATGCCCTGATGAGGTTAAACTCGAGTTTAACCTCATCAGGGCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010561.2-361s21c1
Sequence:CCGGGCTGTCTCTGACTGGATTGATCTCGAGATCAATCCAGTCAGAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010561.2-1772s21c1
Sequence:CCGGCTACTGAGCAGGGACCGATTTCTCGAGAAATCGGTCCCTGCTCAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010561.2-3144s21c1
Sequence:CCGGTGTTAGTTACCATTACGTAAACTCGAGTTTACGTAATGGTAACTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010561.2-2910s21c1
Sequence:CCGGGAACTACCAGTACAGATAAAGCTCGAGCTTTATCTGTACTGGTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010561
VALIDATED
ILF3 MISSION shRNA shRNA Plasmid DNA
interleukin enhancer binding factor 3, 90kDa
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010561.1-759s1c1
Sequence:CCGGCCCTGTTGTCAGAGAAGAAATCTCGAGATTTCTTCTCTGACAACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010561.1-370s1c1
Sequence:CCGGGCTGTCTCTGACTGGATTGATCTCGAGATCAATCCAGTCAGAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010561.1-1295s1c1
Sequence:CCGGCGGTGGACTACACTGTTCAAACTCGAGTTTGAACAGTGTAGTCCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010561.1-1809s1c1
Sequence:CCGGGCATGGCAAGAACCCTGTTATCTCGAGATAACAGGGTTCTTGCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010561.1-1966s1c1
Sequence:CCGGGCAAAGGCTTATGCTGCACTTCTCGAGAAGTGCAGCATAAGCCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010561.2-2973s21c1
Sequence:CCGGCCAACTTGTCTCGGGAGATTGCTCGAGCAATCTCCCGAGACAAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010561.2-1440s21c1
Sequence:CCGGGAATGCCCTGATGAGGTTAAACTCGAGTTTAACCTCATCAGGGCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010561.2-361s21c1
Sequence:CCGGGCTGTCTCTGACTGGATTGATCTCGAGATCAATCCAGTCAGAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010561.2-1772s21c1
Sequence:CCGGCTACTGAGCAGGGACCGATTTCTCGAGAAATCGGTCCCTGCTCAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010561.2-3144s21c1
Sequence:CCGGTGTTAGTTACCATTACGTAAACTCGAGTTTACGTAATGGTAACTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010561.2-2910s21c1
Sequence:CCGGGAACTACCAGTACAGATAAAGCTCGAGCTTTATCTGTACTGGTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010561
VALIDATED
ILF3 MISSION shRNA Lentiviral Transduction Particles
interleukin enhancer binding factor 3, 90kDa
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010561.1-759s1c1
Sequence:CCGGCCCTGTTGTCAGAGAAGAAATCTCGAGATTTCTTCTCTGACAACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010561.1-370s1c1
Sequence:CCGGGCTGTCTCTGACTGGATTGATCTCGAGATCAATCCAGTCAGAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010561.1-1295s1c1
Sequence:CCGGCGGTGGACTACACTGTTCAAACTCGAGTTTGAACAGTGTAGTCCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010561.1-1809s1c1
Sequence:CCGGGCATGGCAAGAACCCTGTTATCTCGAGATAACAGGGTTCTTGCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010561.1-1966s1c1
Sequence:CCGGGCAAAGGCTTATGCTGCACTTCTCGAGAAGTGCAGCATAAGCCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010561.2-2973s21c1
Sequence:CCGGCCAACTTGTCTCGGGAGATTGCTCGAGCAATCTCCCGAGACAAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010561.2-1440s21c1
Sequence:CCGGGAATGCCCTGATGAGGTTAAACTCGAGTTTAACCTCATCAGGGCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010561.2-361s21c1
Sequence:CCGGGCTGTCTCTGACTGGATTGATCTCGAGATCAATCCAGTCAGAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010561.2-1772s21c1
Sequence:CCGGCTACTGAGCAGGGACCGATTTCTCGAGAAATCGGTCCCTGCTCAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010561.2-3144s21c1
Sequence:CCGGTGTTAGTTACCATTACGTAAACTCGAGTTTACGTAATGGTAACTAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010561.2-2910s21c1
Sequence:CCGGGAACTACCAGTACAGATAAAGCTCGAGCTTTATCTGTACTGGTAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)